Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs2383206 [Homo sapiens]
    TTTTCCTTAGAAATGTTATTGTAGT[A/G]TTTGCAAGATGGCCTGAATCCTGAA
    Chromosome:
    9:22115027
    Gene:
    CDKN2B-AS1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.4876/2442
    HGVS:
    NC_000009.11:g.22115026A>G, NC_000009.12:g.22115027A>G, NR_003529.3:n.2908+1228A>G, NR_047532.1:n.1697+1228A>G, NR_047534.1:n.961+1228A>G, NR_047535.1:n.856+2632A>G, NR_047536.1:n.720+2632A>G, NR_047537.1:n.781-5173A>G, NR_047538.1:n.645-5173A>G, NR_047543.1:n.990+1228A>G, NR_120536.1:n.645-5477A>G

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center