Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs6295 [Homo sapiens]
    GAGAACGGAGGTAGCTTTTTAAAAA[C/G]GAAGACACACTCGGTCTTCTTCCAT
    Chromosome:
    5:63962738
    Gene:
    HTR1A (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Allele Origin:
    G(germline)/C(germline)
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    C=0.4533/2270
    HGVS:
    CM000667.2:g.63962738C>G, NC_000005.10:g.63962738C>G, NC_000005.9:g.63258565C>G, NG_032816.1:g.4555G>C, NM_000524.3:c.-1019G>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center