Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 15

1.

rs17300539 [Homo sapiens]
    TCAGAATGTGTGGCTTGCAAGAACC[A/G]GCTCAGATCCTGCCCTTCAAAAACA
    Chromosome:
    3:186841671
    Gene:
    ADIPOQ (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0268/134
    HGVS:
    NC_000003.11:g.186559460G>A, NC_000003.12:g.186841671G>A, NG_021140.1:g.3998G>A, NM_001177800.1:c.-1138G>A, NM_004797.3:c.-1087G>A
    2.

    rs12733285 [Homo sapiens]
      TCATGCTATGCTCAACCCACAAGCA[C/T]AGTTGAAAGCAACCGGCAATCTAGT
      Chromosome:
      1:202952912
      Gene:
      ADIPOR1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.2089/1046
      HGVS:
      NC_000001.10:g.202922040C>T, NC_000001.11:g.202952912C>T, NM_001290553.1:c.-94-1748G>A, NM_001290557.1:c.-95+1329G>A, NM_001290629.1:c.-95+1329G>A, NM_015999.5:c.-94-1748G>A, NR_046083.1:n.165+1329G>A, XM_017001407.1:c.-586+1329G>A
      3.

      rs10920531 [Homo sapiens]
        AAACTTGACTCTTGACATGAACCCA[A/C]CTTTAACTCAAAAAGACTGCCCTTA
        Chromosome:
        1:202939708
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.4776/2392
        HGVS:
        NC_000001.10:g.202908836A>C, NC_000001.11:g.202939708A>C
        4.

        rs7539542 [Homo sapiens]
          CATGTGAAATCTTTGAATGCCAAGT[C/G]TCTTCTGTACTTTCTTTTATTAACA
          Chromosome:
          1:202940846
          Gene:
          ADIPOR1 (GeneView)
          Functional Consequence:
          utr variant 3 prime
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.4694/2351
          HGVS:
          NC_000001.10:g.202909974G>C, NC_000001.11:g.202940846G>C, NM_001290553.1:c.*727C>G, NM_001290557.1:c.*727C>G, NM_001290629.1:c.*727C>G, NM_015999.5:c.*727C>G, NR_046083.1:n.2114C>G, XM_017001407.1:c.*727C>G
          5.

          rs2241766 [Homo sapiens]
            TTCTACTGCTATTAGCTCTGCCCGG[G/T]CATGACCAGGAAACCACGACTCAAG
            Chromosome:
            3:186853103
            Gene:
            ADIPOQ-AS1 (GeneView) ADIPOQ (GeneView)
            Functional Consequence:
            nc transcript variant,synonymous codon
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            G=0.1514/758
            HGVS:
            NC_000003.11:g.186570892T>G, NC_000003.12:g.186853103T>G, NG_021140.1:g.15430T>G, NM_001177800.1:c.45T>G, NM_004797.3:c.45T>G, NP_001171271.1:p.Gly15, NP_004788.1:p.Gly15, NR_046662.1:n.2226A>C
            6.

            rs2232853 [Homo sapiens]
              CAGCTTGAGGCAGGCTGAGTATACC[C/T]ATTCCCAGCTGCTGCTACCACTTGA
              Chromosome:
              1:202962830
              Gene:
              CYB5R1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              A=0.1372/687
              HGVS:
              NC_000001.10:g.202931958G>A, NC_000001.11:g.202962830G>A, NM_016243.2:c.746-131C>T
              7.

              rs2117985 [Homo sapiens]
                CTATCAAAAAGACACATGCACCTGT[A/G]TGTTCATCGCAATATTATTCGCAAT
                Chromosome:
                3:186835056
                Validated:
                by 1000G,by cluster,by frequency
                Global MAF:
                G=0.0927/464
                HGVS:
                NC_000003.11:g.186552845A>G, NC_000003.12:g.186835056A>G
                8.

                rs1501299 [Homo sapiens]
                  TCTAGGCCTTAGTTAATAATGAATG[A/C]CTTCATATAGTTTATATCAGTGTAG
                  Chromosome:
                  3:186853334
                  Gene:
                  ADIPOQ-AS1 (GeneView) ADIPOQ (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.3003/1504
                  HGVS:
                  NC_000003.11:g.186571123G>T, NC_000003.12:g.186853334G>T, NG_021140.1:g.15661G>T, NM_001177800.1:c.214+62G>T, NM_004797.3:c.214+62G>T, NR_046662.1:n.2087-92C>A
                  9.

                  rs1342387 [Homo sapiens]
                    GCTCTCTGATTCAAAAACATCAACC[A/G]TCAAAGTGTACACATTCCCTTTTTT
                    Chromosome:
                    1:202945228
                    Gene:
                    ADIPOR1 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    T=0.4641/2324
                    HGVS:
                    NC_000001.10:g.202914356T>C, NC_000001.11:g.202945228T>C, NM_001290553.1:c.431-59A>G, NM_001290557.1:c.431-59A>G, NM_001290629.1:c.431-59A>G, NM_015999.5:c.431-59A>G, NR_046083.1:n.690-59A>G, XM_017001407.1:c.-61-33A>G
                    10.

                    rs860291 [Homo sapiens]
                      TTCCACCTTGTGCAATAGCTACAGC[C/T]TTCTCTAACCAGCTGCATTCTTATA
                      Chromosome:
                      3:186840168
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      T=0.0893/447
                      HGVS:
                      NC_000003.11:g.186557957T>C, NC_000003.12:g.186840168T>C, NG_021140.1:g.2495T>C
                      11.

                      rs822396 [Homo sapiens]
                        GTAGGAGAAAGAGATCTTTATTTTT[A/G]ACAAAGGGGGAGGAGCCAGAAAACT
                        Chromosome:
                        3:186849088
                        Gene:
                        ADIPOQ (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.1737/870
                        HGVS:
                        NC_000003.11:g.186566877G>A, NC_000003.12:g.186849088G>A, NG_021140.1:g.11415G>A, NM_001177800.1:c.-9+3481G>A, NM_004797.3:c.-8-3963G>A
                        12.

                        rs822395 [Homo sapiens]
                          TGATCGCACCTATTAGTGGAGAAAT[A/C/G]TGTCCATAATACTGAAGTTTGGGGA
                          Chromosome:
                          3:186849018
                          Gene:
                          ADIPOQ (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          C=0.3117/1561
                          HGVS:
                          NC_000003.11:g.186566807C>A, NC_000003.12:g.186849018C>A, NC_000003.12:g.186849018C>G, NG_021140.1:g.11345C>A, NG_021140.1:g.11345C>G, NM_001177800.1:c.-9+3411C>A, NM_001177800.1:c.-9+3411C>G, NM_004797.3:c.-8-4033C>A, NM_004797.3:c.-8-4033C>G
                          13.

                          rs822387 [Homo sapiens]
                            agttttgagatttctttatacaatc[C/T]agatccaaatctcttgtctcaaata
                            Chromosome:
                            3:186838248
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            C=0.1334/668
                            HGVS:
                            NC_000003.11:g.186556037T>C, NC_000003.12:g.186838248T>C, NG_021140.1:g.575T>C
                            14.

                            rs266729 [Homo sapiens]
                              TTGCAAGAACCGGCTCAGATCCTGC[A/C/G]CTTCAAAAACAAAACATGAGCGTGC
                              Chromosome:
                              3:186841685
                              Gene:
                              ADIPOQ (GeneView)
                              Functional Consequence:
                              upstream variant 2KB
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              G=0.2264/1134
                              HGVS:
                              NC_000003.11:g.186559474C>G, NC_000003.12:g.186841685C>A, NC_000003.12:g.186841685C>G, NG_021140.1:g.4012C>A, NG_021140.1:g.4012C>G, NM_001177800.1:c.-1124C>A, NM_001177800.1:c.-1124C>G, NM_004797.3:c.-1073C>A, NM_004797.3:c.-1073C>G
                              15.

                              rs226729 [Homo sapiens]
                                aattaagttattattgaatatagtc[A/T]ccctgctgtgcagtcaaataatagg
                                Chromosome:
                                X:99251570
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                T=0.0019/7
                                HGVS:
                                NC_000023.10:g.98506568T>A, NC_000023.11:g.99251570T>A

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center