Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 7

1.

rs113994092 [Homo sapiens]
    TGCATTTCCTTTCTTCCCAGAGACA[C/T]TGCTGCCAGAAACTGCCTCTTGACC
    Chromosome:
    2:29209873
    Gene:
    ALK (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    T(germline)/C(germline,unknown)
    Clinical significance:
    Pathogenic
    Validated:
    no info
    HGVS:
    NC_000002.11:g.29432739A>G, NC_000002.12:g.29209873A>G, NG_009445.1:g.716694T>C, NM_004304.3:c.3749T>C, NM_004304.4:c.3749T>C, NP_004295.2:p.Ile1250Thr
    2.

    rs113994089 [Homo sapiens]
      GGGGTGAGCCTGCAATCCCTGCCCC[C/G]GTTCATCCTGCTGGAGCTCATGGCG
      Chromosome:
      2:29220776
      Gene:
      ALK (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      G(germline)/C(germline)
      Clinical significance:
      Likely pathogenic
      Validated:
      by cluster
      HGVS:
      NC_000002.11:g.29443642C>G, NC_000002.12:g.29220776C>G, NG_009445.1:g.705791G>C, NM_004304.3:c.3575G>C, NM_004304.4:c.3575G>C, NP_004295.2:p.Arg1192Pro
      3.

      rs113994088 [Homo sapiens]
        AGGGGTCTGGGCCATGGCGCCTTTG[C/G]GGAGGTGTATGAAGGCCAGGTGTCC
        Chromosome:
        2:29222584
        Gene:
        ALK (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        G(germline)/C(germline)
        Clinical significance:
        Likely pathogenic
        Validated:
        by cluster
        HGVS:
        NC_000002.11:g.29445450C>G, NC_000002.12:g.29222584C>G, NG_009445.1:g.703983G>C, NM_004304.3:c.3383G>C, NM_004304.4:c.3383G>C, NP_004295.2:p.Gly1128Ala
        4.

        rs113994087 [Homo sapiens]
          AAGATTGGAGACTTCGGGATGGCCC[A/G/T]AGACATCTACAGGTGAGTAAAGACT
          Chromosome:
          2:29209798
          Gene:
          ALK (GeneView)
          Functional Consequence:
          missense
          Allele Origin:
          G(germline)/T(germline,somatic)/A(germline,somatic)
          Clinical significance:
          Pathogenic
          Validated:
          by cluster
          HGVS:
          NC_000002.11:g.29432664C>T, NC_000002.12:g.29209798C>T, NG_009445.1:g.716769G>A, NM_004304.3:c.3824G>A, NM_004304.4:c.3824G>A, NP_004295.2:p.Arg1275Gln
          5.

          rs2008535 [Homo sapiens]
            CGTTTTAAAATCCAGAAACATCACA[A/T]GGTAGCCACATCCGGCGGCTGTTAC
            Chromosome:
            2:31137814
            Gene:
            GALNT14 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            A=0.2963/1484
            HGVS:
            NC_000002.11:g.31360680T>A, NC_000002.12:g.31137814T>A, NG_051040.1:g.5913A>T, NM_001253826.1:c.129+144A>T, NM_001329095.1:c.-110+144A>T, NM_001329096.1:c.-117+144A>T, NM_001329097.1:c.129+144A>T, NM_024572.3:c.129+144A>T, NR_045602.1:n.769+144A>T, XM_005264559.1:c.-110+144A>T, XM_011533105.1:c.-117+144A>T, XM_017004908.1:c.129+144A>T
            6.

            rs1862110 [Homo sapiens]
              GGTTCCTCTTTTTGATTGCATGCCC[C/T]TTAGAAGAAAATCATTGATACATTG
              Chromosome:
              2:15062556
              Gene:
              NBAS (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              G=0.4800/2404
              HGVS:
              NC_000002.11:g.15202680A>G, NC_000002.12:g.15062556A>G, XM_017004317.1:c.*49-64332T>C
              7.

              rs1344063 [Homo sapiens]
                TTGTCTTCTGGGCTACAGTTGCAGA[C/G/T]GGGAGATGAGAGAACAGTGCCAAGC
                Chromosome:
                2:20961673
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                T=0.3830/1918
                HGVS:
                NC_000002.11:g.21184545T>C, NC_000002.12:g.20961673T>C, NC_000002.12:g.20961673T>G

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Support Center