Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 7

1.

rs3733890 [Homo sapiens]
    ATGAAGGAGGGCTTGGAGGCTGCCC[A/G]ACTGAAAGCTCACCTGATGAGCCAG
    Chromosome:
    5:79126136
    Gene:
    BHMT (GeneView)
    Functional Consequence:
    missense
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2907/1456
    HGVS:
    NC_000005.10:g.79126136G>A, NC_000005.9:g.78421959G>A, NG_029156.1:g.19356G>A, NM_001713.2:c.716G>A, NP_001704.2:p.Arg239Gln, XM_005248566.1:c.257G>A, XP_005248623.1:p.Arg86Gln

    Display Settings:

    Format
    Items per page
    Sort by

    Send to:

    Choose Destination

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center