Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs1426654 [Homo sapiens]
    TGGATTGTCTCAGGATGTTGCAGGC[A/G/T]CAACTTTCATGGCAGCGGGCAGTTC
    Chromosome:
    15:48134287
    Gene:
    MYEF2 (GeneView) SLC24A5 (GeneView)
    Functional Consequence:
    downstream variant 500B,missense,utr variant 5 prime
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.4377/2192
    HGVS:
    NC_000015.10:g.48134287A, NC_000015.10:g.48134287A>G, NC_000015.10:g.48134287A>T, NC_000015.9:g.48426484A, NC_000015.9:g.48426484A>G, NC_000015.9:g.48426484A>T, NG_011500.1:g.18316A, NG_011500.1:g.18316A>G, NG_011500.1:g.18316A>T, NM_205850.2:c.331A, NM_205850.2:c.331A>G, NM_205850.2:c.331A>T, NP_995322.1:p.Thr111, NP_995322.1:p.Thr111Ala, NP_995322.1:p.Thr111Ser, XM_005254308.1:c.331A, XM_005254308.1:c.331A>G, XM_005254308.1:c.331A>T, XM_005254309.1:c.151A, XM_005254309.1:c.151A>G, XM_005254309.1:c.151A>T, XM_005254425.4:c.*8776T, XM_005254425.4:c.*8776T>A, XM_005254425.4:c.*8776T>C, XM_017022079.1:c.-9A, XM_017022079.1:c.-9A>G, XM_017022079.1:c.-9A>T, XM_017022080.1:c.-9A, XM_017022080.1:c.-9A>G, XM_017022080.1:c.-9A>T, XM_017022285.1:c.*8776T, XM_017022285.1:c.*8776T>A, XM_017022285.1:c.*8776T>C, XM_017022286.1:c.*8776T, XM_017022286.1:c.*8776T>A, XM_017022286.1:c.*8776T>C, XM_017022287.1:c.*8776T, XM_017022287.1:c.*8776T>A, XM_017022287.1:c.*8776T>C, XM_017022291.1:c.*8776T, XM_017022291.1:c.*8776T>A, XM_017022291.1:c.*8776T>C, XM_017022292.1:c.*8776T, XM_017022292.1:c.*8776T>A, XM_017022292.1:c.*8776T>C, XP_005254365.1:p.Thr111, XP_005254365.1:p.Thr111Ala, XP_005254365.1:p.Thr111Ser, XP_005254366.1:p.Thr51, XP_005254366.1:p.Thr51Ala, XP_005254366.1:p.Thr51Ser

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center