Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 23

1.

rs28360476 [Homo sapiens]
    TGGTGCTCCTGAGAACCGTGCCATT[A/C]CCGAAGGAGCCCACCTGCAGAACAC
    Chromosome:
    12:121033729
    Gene:
    OASL (GeneView)
    Functional Consequence:
    synonymous codon
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.0006/3
    HGVS:
    NC_000012.11:g.121471532C>A, NC_000012.12:g.121033729C>A, NM_001261825.1:c.213G>T, NM_003733.3:c.213G>T, NM_198213.2:c.213G>T, NP_001248754.1:p.Gly71, NP_003724.1:p.Gly71, NP_937856.1:p.Gly71, XM_017020140.1:c.213G>T, XM_017020141.1:c.213G>T, XP_016875629.1:p.Gly71, XP_016875630.1:p.Gly71
    2.

    rs12811390 [Homo sapiens]
      caaaaaaTATATATATATATAAACT[C/T]ATAGGGAGAACCAGGAACCAGTTcc
      Chromosome:
      12:121032217
      Gene:
      OASL (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.1104/553
      HGVS:
      NC_000012.11:g.121470020C>T, NC_000012.12:g.121032217C>T, NM_001261825.1:c.482-600G>A, NM_003733.3:c.482-600G>A, NM_198213.2:c.482-600G>A, XM_017020140.1:c.482-600G>A, XM_017020141.1:c.482-600G>A
      3.

      rs12693590 [Homo sapiens]
        gcactgcgctaggtcctgctggggg[A/C]aaagggtgacaaaggcatgtctctg
        Chromosome:
        2:190993910
        Gene:
        STAT1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.0631/316
        HGVS:
        NC_000002.11:g.191858636A>C, NC_000002.12:g.190993910A>C, NG_008294.1:g.25341T>G, NM_007315.3:c.944+1151T>G, NM_139266.2:c.944+1151T>G, XM_005246815.1:c.950+1151T>G, XM_005246816.1:c.380+1151T>G, XM_006712718.1:c.944+1151T>G, XM_017004783.1:c.950+1151T>G, XR_001738914.1:n.1337+1151T>G, XR_001738915.1:n.1279+1151T>G
        4.

        rs12315068 [Homo sapiens]
          ACTACAGACATGTGCCACCACGCCC[A/G]GCTAATTTTTTTTTTGTATTTTTAG
          Chromosome:
          12:121039713
          Gene:
          OASL (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          A=0.1857/930
          HGVS:
          NC_000012.11:g.121477516G>A, NC_000012.12:g.121039713G>A, NM_001261825.1:c.-742C>T, NM_003733.3:c.-742C>T, NM_198213.2:c.-742C>T, XM_017020140.1:c.-742C>T, XM_017020141.1:c.-742C>T
          5.

          rs12298890 [Homo sapiens]
            ccttaacagaaaatgagtaaaatag[C/T]tgcagtttgaacTGAAATAAGAACA
            Chromosome:
            12:112917016
            Gene:
            OAS1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            T=0.0012/6
            HGVS:
            NC_000012.11:g.113354821C>T, NC_000012.12:g.112917016C>T, NG_011530.2:g.15083C>T, NM_001032409.2:c.884+278C>T, NM_001320151.1:c.884+278C>T, NM_002534.3:c.884+278C>T, NM_016816.3:c.884+278C>T, XM_006719434.1:c.884+278C>T, XM_011538413.1:c.860+278C>T, XM_017019361.1:c.860+278C>T, XM_017019362.1:c.395+278C>T, XR_944558.1:n.927+278C>T
            6.

            rs10083129 [Homo sapiens]
              taaaagtacaaaaaattagccgggc[A/G]tggtggcaggcacctgtagtcccag
              Chromosome:
              12:121041760
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.0244/122
              HGVS:
              NC_000012.11:g.121479563G>A, NC_000012.12:g.121041760G>A
              7.

              rs3861793 [Homo sapiens]
                GGCTTCCTAAAAAGCAGCAGCAGCT[C/G]GAATTCCAAGGCCAAGTCCTGCAGG
                Chromosome:
                12:121020678
                Gene:
                OASL (GeneView)
                Functional Consequence:
                intron variant,synonymous codon,utr variant 3 prime
                Validated:
                no info
                HGVS:
                NC_000012.11:g.121458481C>G, NC_000012.12:g.121020678C>G, NM_001261825.1:c.1038G>C, NM_003733.3:c.1428G>C, NM_198213.2:c.*418G>C, NP_001248754.1:p.Leu346, NP_003724.1:p.Leu476, XM_017020140.1:c.1048-1648G>C, XM_017020141.1:c.*38-1648G>C
                8.

                rs3213545 [Homo sapiens]
                  TGGAGCAGAGAGTCCCCGATGCTCT[C/T]GTCTTCACCATCCAGACCAGGGGGA
                  Chromosome:
                  12:121033534
                  Gene:
                  OASL (GeneView)
                  Functional Consequence:
                  synonymous codon
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.3131/1568
                  HGVS:
                  NC_000012.11:g.121471337G>A, NC_000012.12:g.121033534G>A, NM_001261825.1:c.408C>T, NM_003733.3:c.408C>T, NM_198213.2:c.408C>T, NP_001248754.1:p.Leu136, NP_003724.1:p.Leu136, NP_937856.1:p.Leu136, XM_017020140.1:c.408C>T, XM_017020141.1:c.408C>T, XP_016875629.1:p.Leu136, XP_016875630.1:p.Leu136
                  9.

                  rs2859398 [Homo sapiens]
                    AGGCAAAGCTTGCAGTGAGCCAAGA[C/T]TGCACCACTGAACTCCAGCGAGACT
                    Chromosome:
                    12:121041852
                    Validated:
                    by 1000G,by cluster,by frequency
                    Global MAF:
                    C=0.3438/1722
                    HGVS:
                    NC_000012.11:g.121479655T>C, NC_000012.12:g.121041852T>C
                    10.

                    rs2834202 [Homo sapiens]
                      AAAATTAGAACAGCTCCCTAGAATT[A/G]TGAACTTTTAAGAGTCTGACTAGAA
                      Chromosome:
                      21:33358648
                      Gene:
                      IFNAR1 (GeneView)
                      Functional Consequence:
                      utr variant 3 prime
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      G=0.1458/730
                      HGVS:
                      NC_000021.8:g.34730954G>A, NC_000021.9:g.33358648G>A, NM_000629.2:c.*3099G>A, XM_005260964.1:c.*3099G>A, XM_005260964.2:c.*3099G>A
                      11.

                      rs2834166 [Homo sapiens]
                        aaaaagatgctttgtagcactaata[A/C]cagcatgatggatagcaggccctaa
                        Chromosome:
                        21:33254349
                        Gene:
                        IFNAR2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        A=0.2672/1338
                        HGVS:
                        NC_000021.8:g.34626654C>A, NC_000021.9:g.33254349C>A, NG_016003.1:g.29424C>A, NM_000874.4:c.709+1519C>A, NM_001289125.1:c.709+1519C>A, NM_001289126.1:c.709+1519C>A, NM_001289128.1:c.709+1519C>A, NM_207584.2:c.709+1519C>A, NM_207585.2:c.709+1519C>A, XM_005260965.1:c.175+1519C>A, XM_005260966.1:c.709+1519C>A, XM_005260967.1:c.709+1519C>A, XM_005260968.1:c.709+1519C>A
                        12.

                        rs2307479 [Homo sapiens]
                          tggatgtttttggtagttgtctgtg[A/C]aatggccatgatcctgtcagttaaa
                          Chromosome:
                          2:37135412
                          Gene:
                          EIF2AK2 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.0543/272
                          HGVS:
                          NC_000002.11:g.37362555T>G, NC_000002.12:g.37135412T>G, NG_030351.1:g.26636A>C, NM_001135651.2:c.785+72A>C, NM_001135652.2:c.785+72A>C, NM_002759.3:c.785+72A>C, XM_005264432.1:c.785+72A>C, XM_011532987.2:c.785+72A>C, XM_017004503.1:c.785+72A>C
                          13.

                          rs2307478 [Homo sapiens]
                            CAAAACACAGAATTGACGGAAAGAC[C/T]TACGTTATTAAACGTGTTAAATATA
                            Chromosome:
                            2:37126321
                            Gene:
                            EIF2AK2 (GeneView)
                            Functional Consequence:
                            intron variant,synonymous codon
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.0164/82
                            HGVS:
                            NC_000002.11:g.37353464A>G, NC_000002.12:g.37126321A>G, NG_030351.1:g.35727T>C, NM_001135651.2:c.876T>C, NM_001135652.2:c.786-3657T>C, NM_002759.3:c.876T>C, NP_001129123.1:p.Thr292, NP_002750.1:p.Thr292, XM_005264432.1:c.876T>C, XM_011532987.2:c.876T>C, XM_017004503.1:c.876T>C, XP_005264489.1:p.Thr292, XP_011531289.1:p.Thr292, XP_016859992.1:p.Thr292
                            14.

                            rs2280234 [Homo sapiens]
                              CATGGACAACTCAGTGGAGTAGCTG[C/T]TGTGGGCTTTTGTATTCTTCGCATC
                              Chromosome:
                              2:190985373
                              Gene:
                              STAT1 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.4071/2039
                              HGVS:
                              NC_000002.11:g.191850099A>G, NC_000002.12:g.190985373A>G, NG_008294.1:g.33878T>C, NM_007315.3:c.1263+246T>C, NM_139266.2:c.1263+246T>C, XM_005246815.1:c.1269+246T>C, XM_005246816.1:c.699+246T>C, XM_006712718.1:c.1263+246T>C, XM_017004783.1:c.1269+246T>C, XR_001738914.1:n.1656+246T>C, XR_001738915.1:n.1598+246T>C
                              15.

                              rs2228259 [Homo sapiens]
                                TGGAAGGCCCAGCAGCAAAAAGCCT[C/G/T]CATCAGAGCTCCCATTGACCACGGG
                                Chromosome:
                                12:56354511
                                Gene:
                                STAT2 (GeneView)
                                Functional Consequence:
                                missense,nc transcript variant,utr variant 5 prime
                                Validated:
                                by 1000G,by cluster,by frequency
                                Global MAF:
                                G=0.0002/1
                                HGVS:
                                NC_000012.11:g.56748295C>G, NC_000012.12:g.56354511C>A, NC_000012.12:g.56354511C>G, NG_046314.1:g.10743G>C, NG_046314.1:g.10743G>T, NM_005419.3:c.737G>C, NM_005419.3:c.737G>T, NM_198332.1:c.725G>C, NM_198332.1:c.725G>T, NP_005410.1:p.Cys246Phe, NP_005410.1:p.Cys246Ser, NP_938146.1:p.Cys242Phe, NP_938146.1:p.Cys242Ser, XM_005269108.1:c.941G>C, XM_005269109.1:c.929G>C, XM_005269110.1:c.941G>C, XM_005269111.1:c.941G>C, XM_005269111.3:c.737G>C, XM_005269111.3:c.737G>T, XM_011538697.2:c.737G>C, XM_011538697.2:c.737G>T, XM_011538698.2:c.725G>C, XM_011538698.2:c.725G>T, XM_011538699.2:c.737G>C, XM_011538699.2:c.737G>T, XM_011538700.2:c.-43G>C, XM_011538700.2:c.-43G>T, XM_017019904.1:c.-43G>C, XM_017019904.1:c.-43G>T, XP_005269165.1:p.Cys314Ser, XP_005269166.1:p.Cys310Ser, XP_005269167.1:p.Cys314Ser, XP_005269168.1:p.Cys314Ser, XP_005269168.2:p.Cys246Phe, XP_005269168.2:p.Cys246Ser, XP_011536999.1:p.Cys246Phe, XP_011536999.1:p.Cys246Ser, XP_011537000.1:p.Cys242Phe, XP_011537000.1:p.Cys242Ser, XP_011537001.1:p.Cys246Phe, XP_011537001.1:p.Cys246Ser, XR_001748856.1:n.848G>C, XR_001748856.1:n.848G>T, XR_001748857.1:n.848G>C, XR_001748857.1:n.848G>T, XR_001748858.1:n.809G>C, XR_001748858.1:n.809G>T, XR_001748859.1:n.809G>C, XR_001748859.1:n.809G>T, XR_245953.1:n.961G>C, XR_245953.3:n.848G>C, XR_245953.3:n.848G>T, XR_245954.1:n.946G>C
                                16.

                                rs2066816 [Homo sapiens]
                                  TGCTATTCTTCCACTTCTTGGATCA[A/G/T]CTGAACTATGAGTGTGGCCGTTGCA
                                  Chromosome:
                                  12:56356219
                                  Gene:
                                  STAT2 (GeneView)
                                  Functional Consequence:
                                  missense,nc transcript variant,synonymous codon,upstream variant 2KB,utr variant 5 prime
                                  Validated:
                                  by cluster,by frequency,by hapmap
                                  HGVS:
                                  NC_000012.11:g.56750003C>A, NC_000012.11:g.56750003C>T, NC_000012.12:g.56356219C>A, NC_000012.12:g.56356219C>T, NG_046314.1:g.9035G>A, NG_046314.1:g.9035G>T, NM_005419.3:c.198G>A, NM_005419.3:c.198G>T, NM_198332.1:c.198G>A, NM_198332.1:c.198G>T, NP_005410.1:p.Gln66, NP_005410.1:p.Gln66His, NP_938146.1:p.Gln66, NP_938146.1:p.Gln66His, XM_005269108.1:c.402G>A, XM_005269108.1:c.402G>T, XM_005269109.1:c.402G>A, XM_005269109.1:c.402G>T, XM_005269110.1:c.402G>A, XM_005269110.1:c.402G>T, XM_005269111.1:c.402G>A, XM_005269111.1:c.402G>T, XM_005269111.3:c.198G>A, XM_005269111.3:c.198G>T, XM_011538697.2:c.198G>A, XM_011538697.2:c.198G>T, XM_011538698.2:c.198G>A, XM_011538698.2:c.198G>T, XM_011538699.2:c.198G>A, XM_011538699.2:c.198G>T, XM_011538700.2:c.-1588G>A, XM_011538700.2:c.-1588G>T, XM_017019904.1:c.-994G>A, XM_017019904.1:c.-994G>T, XP_005269165.1:p.Gln134, XP_005269165.1:p.Gln134His, XP_005269166.1:p.Gln134, XP_005269166.1:p.Gln134His, XP_005269167.1:p.Gln134, XP_005269167.1:p.Gln134His, XP_005269168.1:p.Gln134, XP_005269168.1:p.Gln134His, XP_005269168.2:p.Gln66, XP_005269168.2:p.Gln66His, XP_011536999.1:p.Gln66, XP_011536999.1:p.Gln66His, XP_011537000.1:p.Gln66, XP_011537000.1:p.Gln66His, XP_011537001.1:p.Gln66, XP_011537001.1:p.Gln66His, XR_001748856.1:n.309G>A, XR_001748856.1:n.309G>T, XR_001748857.1:n.309G>A, XR_001748857.1:n.309G>T, XR_001748858.1:n.282G>A, XR_001748858.1:n.282G>T, XR_001748859.1:n.282G>A, XR_001748859.1:n.282G>T, XR_245953.1:n.422G>A, XR_245953.1:n.422G>T, XR_245953.3:n.309G>A, XR_245953.3:n.309G>T, XR_245954.1:n.419G>A, XR_245954.1:n.419G>T
                                  18.

                                  rs2010604 [Homo sapiens]
                                    gaactctctgccatccctATATAAA[A/C/G]TATTTAGATTTGGCAAGGAGAGGCC
                                    Chromosome:
                                    12:112970403
                                    Gene:
                                    OAS3 (GeneView)
                                    Functional Consequence:
                                    utr variant 3 prime
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                    Global MAF:
                                    G=0.1817/910
                                    HGVS:
                                    NC_000012.11:g.113408208G>C, NC_000012.12:g.112970403G>C, NC_000012.12:g.112970403G>T, NM_006187.3:c.*430G>C, NM_006187.3:c.*430G>T, XM_005253889.1:c.*430G>C, XM_005253889.3:c.*430G>C, XM_005253889.3:c.*430G>T, XM_017019363.1:c.*430G>C, XM_017019363.1:c.*430G>T
                                    19.

                                    rs1316896 [Homo sapiens]
                                      AGTCATGATATTGACATCTGCGGAG[C/G]TTACCACGTGCCAAACACCGTGCGA
                                      Chromosome:
                                      1:27669591
                                      Gene:
                                      IFI6 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000001.10:g.27996102G>C, NC_000001.11:g.27669591G>C, NM_002038.3:c.-32-245C>G, NM_022872.2:c.-32-245C>G, NM_022873.2:c.-32-245C>G
                                      20.

                                      rs1293762 [Homo sapiens]
                                        ATAATAATTTGGAATGTGCAGCTTT[A/C]CCACCATCTAGTGGCAGCTTCTGGG
                                        Chromosome:
                                        12:112993031
                                        Gene:
                                        OAS2 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                        Global MAF:
                                        T=0.2288/1146
                                        HGVS:
                                        NC_000012.11:g.113430836T>G, NC_000012.12:g.112993031T>G, NG_029692.1:g.19563T>G, NM_002535.2:c.449-2265T>G, NM_016817.2:c.449-2265T>G, XR_001748725.1:n.663-2265T>G

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center