Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 16

1.

rs16902124 [Homo sapiens]
    GCAAGACTTCAAGGGTGCGGCCAAG[A/G]CTAGATGCTGTTGGTTTGACCTGCG
    Chromosome:
    8:127344972
    Gene:
    CASC21 (GeneView) CASC8 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.1110/556
    HGVS:
    NC_000008.10:g.128357218G>A, NC_000008.11:g.127344972G>A, NR_117099.1:n.457+5537G>A, NR_117099.1:n.457+5538G>A, NR_117100.1:n.1177-54912C>T, NR_117100.1:n.1177-54913C>T
    2.

    rs13281615 [Homo sapiens]
      GTAACTATGAATCTCATCAAAAGAA[A/G]GCAGAACGCAGATATTCTGAGTAGG
      Chromosome:
      8:127343372
      Gene:
      CASC21 (GeneView) CASC8 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.4912/2460
      HGVS:
      NC_000008.10:g.128355618A>G, NC_000008.11:g.127343372A>G, NR_117099.1:n.457+3937A>G, NR_117099.1:n.457+3938A>G, NR_117100.1:n.1177-53312T>C, NR_117100.1:n.1177-53313T>C
      3.

      rs13254738 [Homo sapiens]
        CTCCTCATGGCCTCCTGCAGAATGC[A/C]ATTCTAAAATTAGGTTCTATTTTCC
        Chromosome:
        8:127092098
        Gene:
        PRNCR1 (GeneView)
        Functional Consequence:
        nc transcript variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.4675/2341
        HGVS:
        NC_000008.10:g.128104343C>A, NC_000008.11:g.127092098C>A, NR_109833.1:n.12225C>A, XR_242446.1:n.166-4591G>T
        4.

        rs10808555 [Homo sapiens]
          AAGAAAGAAGTGAATTGAGGCCATG[A/G]AGTTACTTCAGTTGTCAAATGTTCC
          Chromosome:
          8:127397266
          Gene:
          CASC8 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          G=0.3327/1666
          HGVS:
          NC_000008.10:g.128409511G>A, NC_000008.11:g.127397266G>A, NR_117100.1:n.1176+23563C>T
          5.

          rs10505477 [Homo sapiens]
            TTGTCTATCAAACAGGAAGCCTTAA[C/T]TGGAGATGAAGATTTAGAAAAGGGG
            Chromosome:
            8:127395198
            Gene:
            CASC8 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.4231/2119
            HGVS:
            NC_000008.10:g.128407443A>G, NC_000008.11:g.127395198A>G, NR_117100.1:n.1176+25631T>C
            6.

            rs10505476 [Homo sapiens]
              GGCAAAGCTTCACAGAGGACACACC[A/G]AGGAGGCTGAATCTGGAAAGGTGAA
              Chromosome:
              8:127395871
              Gene:
              CASC8 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.3419/1712
              HGVS:
              NC_000008.10:g.128408116C>T, NC_000008.11:g.127395871C>T, NR_117100.1:n.1176+24958G>A
              7.

              rs7837688 [Homo sapiens]
                catttcccactagagtggtgcattt[G/T]gtacaattgggtctatgttgacacg
                Chromosome:
                8:127527115
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.1058/530
                HGVS:
                NC_000008.10:g.128539360T>G, NC_000008.11:g.127527115T>G
                8.

                rs7837328 [Homo sapiens]
                  AAAAAAGGAAGCAAAAATTAGCAAA[A/G]AGAAAGTACTAAGTGTATGTCAGAG
                  Chromosome:
                  8:127410882
                  Gene:
                  CASC8 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.4511/2259
                  HGVS:
                  NC_000008.10:g.128423127A>G, NC_000008.11:g.127410882A>G, NR_117100.1:n.1176+9947T>C
                  9.

                  rs7824074 [Homo sapiens]
                    CCACCAGTTCCTGTTCACAACCAAG[G/T]CCCCTTCTCCTTTCCCAGTCTTCCT
                    Chromosome:
                    8:127576577
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.2330/1167
                    HGVS:
                    NC_000008.10:g.128588822T>G, NC_000008.11:g.127576577T>G
                    10.

                    rs6983561 [Homo sapiens]
                      TGCAAACTAATAGAACATATAGCAC[A/C]AAATGATTATATCAATAGAATGCTA
                      Chromosome:
                      8:127094635
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.2173/1088
                      HGVS:
                      NC_000008.10:g.128106880A>C, NC_000008.11:g.127094635A>C, XR_242446.1:n.166-7128T>G
                      11.

                      rs6983267 [Homo sapiens]
                        GTCCTTTGAGCTCAGCAGATGAAAG[G/T]CACTGAGAAAAGTACAAAGAATTTT
                        Chromosome:
                        8:127401060
                        Gene:
                        CASC8 (GeneView) CCAT2 (GeneView)
                        Functional Consequence:
                        intron variant,nc transcript variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.3902/1954
                        HGVS:
                        NC_000008.10:g.128413305G>T, NC_000008.11:g.127401060G>T, NR_109834.1:n.662G>T, NR_117100.1:n.1176+19769C>A
                        12.

                        rs6470494 [Homo sapiens]
                          TGGATTGGAAGTGAAGAAGTCAGTC[C/T]CAAGATACTTGACAATGTCTCCTAT
                          Chromosome:
                          8:127075659
                          Gene:
                          PCAT2 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.2788/1396
                          HGVS:
                          NC_000008.10:g.128087904T>C, NC_000008.11:g.127075659T>C, NR_119373.1:n.350+1167A>G
                          13.

                          rs1456310 [Homo sapiens]
                            CACAGTGAGAAAAAGGAGTAGATGA[C/T]GAGAGAGCAAACTCACAAAATTGCT
                            Chromosome:
                            8:127040188
                            Gene:
                            LOC105375751 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            G=0.4860/2434
                            HGVS:
                            NC_000008.10:g.128052433A>G, NC_000008.11:g.127040188A>G, XR_001746076.1:n.1425-9050A>G
                            14.

                            rs1447295 [Homo sapiens]
                              AGTGCCATTGGGGAGGTATGTAAAA[A/C]GTGCTATGGAAAAAAAGCAACAGGA
                              Chromosome:
                              8:127472793
                              Gene:
                              CASC8 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.1811/907
                              HGVS:
                              NC_000008.10:g.128485038A>C, NC_000008.11:g.127472793A>C, NR_024393.1:n.1041+6290T>G, NR_117100.1:n.1041+6290T>G
                              15.

                              rs1016343 [Homo sapiens]
                                CAAGACCATGTGTTACATTTCCCTC[C/T]CATGATTACTCACAGCTTCACAGTT
                                Chromosome:
                                8:127081052
                                Gene:
                                PCAT2 (GeneView) PRNCR1 (GeneView)
                                Functional Consequence:
                                intron variant,nc transcript variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                T=0.2061/1032
                                HGVS:
                                NC_000008.10:g.128093297C>T, NC_000008.11:g.127081052C>T, NR_109833.1:n.1179C>T, NR_119373.1:n.101+1069G>A
                                16.

                                rs979200 [Homo sapiens]
                                  CAGGCCGATCAGAAATGCTGCTTCT[A/G]TCCAACACTGTGAAAACCTAAGCAC
                                  Chromosome:
                                  8:126911475
                                  Gene:
                                  LOC105375751 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  T=0.4677/2342
                                  HGVS:
                                  NC_000008.10:g.127923720C>T, NC_000008.11:g.126911475C>T, XR_001746076.1:n.1360+33685C>T

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center