Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs708272 [Homo sapiens]
    CCTGGCTCAGATCTGAACCCTAACT[C/T]GAACCCCAGTGATTCTGGGTCTCAG
    Chromosome:
    16:56962376
    Gene:
    CETP (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by submitter
    Global MAF:
    A=0.3776/1891
    HGVS:
    NC_000016.10:g.56962376G>A, NC_000016.9:g.56996288G>A, NG_008952.1:g.5454G>A, NM_000078.2:c.118+279G>A, NM_001286085.1:c.118+279G>A, XM_005255776.1:c.118+279G>A, XM_006721124.3:c.118+279G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center