Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs12847959 [Homo sapiens]
    gccacctgcattttcttaccacatg[C/G]tcttttccatagggcagctctcaaa
    Chromosome:
    X:28774546
    Gene:
    IL1RAPL1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.4583/1730
    HGVS:
    NC_000023.10:g.28792663G>C, NC_000023.11:g.28774546G>C, NG_008292.1:g.191983G>C, NM_014271.3:c.-24-14774G>C, XM_005274441.1:c.-24-14774G>C, XM_017029240.1:c.-24-14774G>C
    2.

    rs6526806 [Homo sapiens]
      CTTTTTAATCTTTGCTTTAGGGAAC[A/G]GCCTTTAAGAGCTGGAAGATGAAAG
      Chromosome:
      X:28789325
      Gene:
      IL1RAPL1 (GeneView)
      Functional Consequence:
      utr variant 5 prime
      Clinical significance:
      Benign
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.2649/1000
      HGVS:
      NC_000023.10:g.28807442G>A, NC_000023.11:g.28789325G>A, NG_008292.1:g.206762G>A, NM_014271.3:c.-19G>A, XM_005274441.1:c.-19G>A, XM_017029240.1:c.-19G>A

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center