Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 20

2.

rs1973172 [Homo sapiens]
    GTAGGGTTTGTTTAGAGGTGGCAAA[G/T]TTAACTTCTAGTGAGAATTATCTTG
    Chromosome:
    5:100302184
    Validated:
    by 1000G,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    C=0.1897/950
    HGVS:
    NC_000005.10:g.100302184A>C, NC_000005.9:g.99637888A>C
    3.

    rs1824780 [Homo sapiens]
      ATGGTATGACATGTAAAGTAATTAT[G/T]GAAATGCCTGATGCATAGCTGGTTC
      Chromosome:
      5:100308375
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      C=0.1823/913
      HGVS:
      NC_000005.10:g.100308375A>C, NC_000005.9:g.99644079A>C
      4.

      rs1824777 [Homo sapiens]
        TCTCTGTGGCAGAGTTCCATTAGAC[A/C]AGAAATAATCTGTAAGTATCCTTCT
        Chromosome:
        5:100278897
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.2901/1453
        HGVS:
        NC_000005.10:g.100278897G>T, NC_000005.9:g.99614601G>T
        6.

        rs1020720 [Homo sapiens]
          ATAAATTTTTTCCCTGTTACGTTCT[A/T]TTATGGAGGGGTGGTCCTTTGAGAG
          Chromosome:
          5:81176949
          Gene:
          RASGRF2 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          T=0.4820/2414
          HGVS:
          NC_000005.10:g.81176949T>A, NC_000005.9:g.80472768T>A, NG_030334.1:g.221261T>A, NM_006909.2:c.2687-3226T>A, XM_005248564.1:c.2471-3226T>A, XM_005248565.1:c.2687-3226T>A, XM_017009682.1:c.2402-3226T>A
          7.

          rs984091 [Homo sapiens]
            TTAAATAACAATGGTACCAGCAGCA[C/G]GGAGTCACATAATAGACAACATGTT
            Chromosome:
            5:67246805
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            G=0.4573/2290
            HGVS:
            NC_000005.10:g.67246805G>C, NC_000005.9:g.66542633G>C
            8.

            rs916336 [Homo sapiens]
              GAGGGTATTTGCTGTCTGGCTGTCT[C/G]TCTCTGTCCCTCTATGTCTCATGGA
              Chromosome:
              22:36188350
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              C=0.3578/1792
              HGVS:
              NC_000022.10:g.36584398C>G, NC_000022.11:g.36188350C>G, NG_023437.1:g.21484G>C
              9.

              rs760482 [Homo sapiens]
                GAGGGAAGGTCTGCAGTCGCTTATA[A/C/G]TCAGCCTCATCTTTCTTCCCTTCTG
                Chromosome:
                22:38782696
                Gene:
                DNAL4 (GeneView)
                Functional Consequence:
                missense,synonymous codon
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                G=0.4125/2066
                HGVS:
                NC_000022.10:g.39178701A>C, NC_000022.10:g.39178701A>G, NC_000022.11:g.38782696A>C, NC_000022.11:g.38782696A>G, NG_041804.1:g.16461T>C, NG_041804.1:g.16461T>G, NM_005740.2:c.36T>C, NM_005740.2:c.36T>G, NP_005731.1:p.Asp12, NP_005731.1:p.Asp12Glu
                10.

                rs738733 [Homo sapiens]
                  ATATGAGAATATTCTTTCCCATAAA[A/C]ATGCAAAAGCACAAACTGATAAATT
                  Chromosome:
                  22:47899668
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.4209/2108
                  HGVS:
                  NC_000022.10:g.48295417A>C, NC_000022.11:g.47899668A>C
                  11.

                  rs734139 [Homo sapiens]
                    CCATGAGAGCATGTGGGGTGGTGCG[C/T]GGTGATGGTGTCATTGCATCGCTGA
                    Chromosome:
                    22:37186126
                    Gene:
                    C1QTNF6 (GeneView)
                    Functional Consequence:
                    intron variant,utr variant 5 prime
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.3153/1579
                    HGVS:
                    NC_000022.10:g.37582166C>T, NC_000022.11:g.37186126C>T, NM_031910.3:c.52-671G>A, NM_182486.1:c.52-671G>A, XM_005261325.1:c.-597-80G>A, XM_005261327.1:c.-436-80G>A, XM_011529857.1:c.-6-671G>A, XM_017028569.1:c.-205G>A, XM_017028570.1:c.-6-671G>A, XM_017028571.1:c.-6-671G>A, XM_017028572.1:c.-6-671G>A, XM_017028573.1:c.-6-671G>A, XM_017028574.1:c.-6-671G>A
                    12.

                    rs728591 [Homo sapiens]
                      cgatgactgattttatttattttct[A/T]tatatgcatttaaggctattaattt
                      Chromosome:
                      22:47875964
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      T=0.2871/1438
                      HGVS:
                      NC_000022.10:g.48271713A>T, NC_000022.11:g.47875964A>T
                      14.

                      rs506056 [Homo sapiens]
                        ATGTGTATATTCATAAGGTTGCCAG[G/T]TTTCCCCTAGGTTGAAATAGCAGCC
                        Chromosome:
                        5:39863861
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        G=0.1885/944
                        HGVS:
                        NC_000005.10:g.39863861G>T, NC_000005.9:g.39863963G>T
                        15.

                        rs428538 [Homo sapiens]
                          CACTCTAAAGCCATGTAGGTCTTCA[C/T]GTTCTGTAATATTTATTCCTTCTTT
                          Chromosome:
                          5:104690006
                          Gene:
                          LOC105379109 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          T=0.3205/1605
                          HGVS:
                          NC_000005.10:g.104690006C>T, NC_000005.9:g.104025707C>T, XR_948647.1:n.310-59350G>A
                          16.

                          rs421508 [Homo sapiens]
                            GCAGTCAAAACTTTGTGTAATGCAC[A/G]AAACTATTAAAAAATATTGTATAAA
                            Chromosome:
                            5:84016631
                            Gene:
                            EDIL3 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.4028/2017
                            HGVS:
                            NC_000005.10:g.84016631A>G, NC_000005.9:g.83312450A>G, NM_001278642.1:c.1107+43669T>C, NM_005711.4:c.1137+43669T>C
                            18.

                            rs141418 [Homo sapiens]
                              tattttggttctggacttctttcaa[C/T]tgacaaaatacatttaagatgtatc
                              Chromosome:
                              22:34137753
                              Gene:
                              LL22NC03-86D4.1 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              C=0.1126/564
                              HGVS:
                              NC_000022.10:g.34533742C>T, NC_000022.11:g.34137753C>T, XR_938189.2:n.381-23843C>T, XR_938190.2:n.381-23843C>T, XR_938191.2:n.381-23843C>T, XR_938192.2:n.381-23843C>T, XR_938193.2:n.381-23843C>T, XR_938194.2:n.381-23843C>T, XR_938196.2:n.330-23843C>T, XR_938197.2:n.381-23843C>T, XR_938198.2:n.380+28319C>T, XR_938199.2:n.221-23843C>T
                              19.

                              rs132404 [Homo sapiens]
                                TCATCTCCCGGGCCTTGGCTCAAAT[A/G]CACCTGGAGGTAGCGGTGAGCCCTT
                                Chromosome:
                                22:44734493
                                Gene:
                                PRR5-ARHGAP8 (GeneView) PRR5 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                G=0.4419/2213
                                HGVS:
                                NC_000022.10:g.45130373A>G, NC_000022.11:g.44734493A>G, NG_029235.1:g.70947A>G, NG_046967.1:g.37296A>G, NM_001017528.2:c.529-534A>G, NM_001017529.2:c.271-534A>G, NM_001017530.1:c.271-534A>G, NM_001198721.1:c.625-534A>G, NM_015366.3:c.529-534A>G, NM_181333.3:c.556-534A>G, NM_181334.5:c.322+7859A>G, XM_005261672.1:c.235-534A>G, XM_005261674.1:c.323-2279A>G, XM_005261675.1:c.555+2102A>G
                                20.

                                rs80533 [Homo sapiens]
                                  ctggcctgccacaCAACCTCACTGG[A/G]GTACACCAACCTCAGATCTAATCCT
                                  Chromosome:
                                  22:40689965
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  A=0.1741/872
                                  HGVS:
                                  NC_000022.10:g.41085969A>G, NC_000022.11:g.40689965A>G

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center