Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 10

1.

rs17782313 [Homo sapiens]
    GTTTAAAGCAGGAGAGATTGTATCC[C/T]GATGGAAATGACAAGAAAAGCTTCA
    Chromosome:
    18:60183864
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    C=0.2400/1202
    HGVS:
    CM000680.2:g.60183864T>C, NC_000018.9:g.57851097T>C
    2.

    rs17700633 [Homo sapiens]
      GTTTCACTGTGTGGCAAGACAGAAT[A/G]TTGTGGTACCCGGTCGCTGCTAAGG
      Chromosome:
      18:60262199
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      A=0.2434/1219
      HGVS:
      CM000680.2:g.60262199G>A, NC_000018.9:g.57929432G>A
      3.

      rs12955983 [Homo sapiens]
        TCTTAGGGGTTGTTTTAGAAAACTG[A/G]GCTGGAACCAATGGTTTACAGTTAT
        Chromosome:
        18:60205756
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        G=0.1971/987
        HGVS:
        CM000680.2:g.60205756A>G, NC_000018.9:g.57872989A>G
        4.

        rs10498767 [Homo sapiens]
          ATTTACCTGTCAAATTTAATACCAA[C/G]ATATGAGACCTGGCCACTACGTACC
          Chromosome:
          6:46395820
          Gene:
          RCAN2 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency
          Global MAF:
          C=0.4926/2467
          HGVS:
          CM000668.2:g.46395820C>G, NC_000006.11:g.46363557C>G, NC_000006.12:g.46395820C>G, NG_030437.1:g.101248G>C, NM_001251973.1:c.225+60932G>C, NM_001251974.1:c.225+60932G>C
          5.

          rs9956279 [Homo sapiens]
            tacaagtgtgagtcaccatgcccga[A/C/T]cTCTATATTCTCTTTTATTTCCATT
            Chromosome:
            18:60275566
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            T=0.1771/887
            HGVS:
            CM000680.2:g.60275566C>A, CM000680.2:g.60275566C>T, NC_000018.9:g.57942799C>T
            6.

            rs9939609 [Homo sapiens]
              GGTTCCTTGCGACTGCTGTGAATTT[A/T]GTGATGCACTTGGATAGTCTCTGTT
              Chromosome:
              16:53786615
              Gene:
              FTO (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency
              Global MAF:
              A=0.3401/1703
              HGVS:
              CM000678.2:g.53786615T>A, NC_000016.10:g.53786615T>A, NC_000016.9:g.53820527T>A, NG_012969.1:g.87653T>A, NM_001080432.2:c.46-23525T>A, XR_001751980.1:n.232-23525T>A
              7.

              rs2229616 [Homo sapiens]
                CGTTTCAAATGGATCAGAAACCATT[A/G]TCATCACCCTATTAAACAGTACAGA
                Chromosome:
                18:60372043
                Gene:
                MC4R (GeneView)
                Functional Consequence:
                missense
                Clinical significance:
                other
                Validated:
                by 1000G,by cluster,by frequency
                Global MAF:
                T=0.0162/81
                HGVS:
                CM000680.2:g.60372043C>T, NC_000018.10:g.60372043C>T, NC_000018.9:g.58039276C>T, NG_016441.1:g.5726G>A, NM_005912.2:c.307G>A, NP_005903.2:p.Val103Ile
                8.

                rs1121980 [Homo sapiens]
                  GTAGGCAGGTGGATCTGAAATCTCA[C/G/T]ATAGTACCAAGACACGTGACTAGGA
                  Chromosome:
                  16:53775335
                  Gene:
                  FTO (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.3704/1855
                  HGVS:
                  CM000678.2:g.53775335G>A, CM000678.2:g.53775335G>C, NC_000016.10:g.53775335G>A, NC_000016.10:g.53775335G>C, NC_000016.9:g.53809247G>A, NG_012969.1:g.76373G>A, NG_012969.1:g.76373G>C, NM_001080432.2:c.46-34805G>A, NM_001080432.2:c.46-34805G>C, XR_001751980.1:n.232-34805G>A, XR_001751980.1:n.232-34805G>C
                  9.

                  rs748192 [Homo sapiens]
                    AGCAGGGAGGAATCTGTGCCCTTTT[A/T]AAAACTGAGCATTGTGTATATATGC
                    Chromosome:
                    3:5847593
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.1400/701
                    HGVS:
                    CM000665.2:g.5847593T>A, NC_000003.11:g.5889280T>A
                    10.

                    rs718475 [Homo sapiens]
                      ggagggaagggctgaaaaactaaca[C/T]attggatactaaaatcactacaatg
                      Chromosome:
                      18:60270226
                      Validated:
                      by 1000G,by cluster,by frequency
                      Global MAF:
                      G=0.1707/855
                      HGVS:
                      CM000680.2:g.60270226A>G, NC_000018.9:g.57937459A>G

                      Display Settings:

                      Format
                      Items per page
                      Sort by

                      Send to:

                      Choose Destination

                      Supplemental Content

                      Find related data

                      Recent activity

                      Your browsing activity is empty.

                      Activity recording is turned off.

                      Turn recording back on

                      See more...
                      Support Center