Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 52

2.

rs12198986 [Homo sapiens]
    CGAGCCGTTATCATTTTTTGTCTGA[A/G]CATAAACGGTTTCCTGACTAGTGTC
    Chromosome:
    6:7719826
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.3395/1700
    HGVS:
    NC_000006.11:g.7720059G>A, NC_000006.12:g.7719826G>A
    3.

    rs11611208 [Homo sapiens]
      GAAACCTGTAGGTTTGGTTTTGGAA[A/G]TCATCATAAAACTTAAGATATTTTT
      Chromosome:
      12:20605679
      Gene:
      PDE3A (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.0270/135
      HGVS:
      NC_000012.11:g.20758613G>A, NC_000012.12:g.20605679G>A, NG_030033.1:g.241435G>A, NM_000921.4:c.1012-7764G>A, NM_001244683.1:c.46-7764G>A, XM_005253389.1:c.49-7764G>A, XM_017019420.1:c.1012-7764G>A, XM_017019421.1:c.49-7764G>A
      4.

      rs11205277 [Homo sapiens]
        atcaccacacgaacatctaataagc[A/C/G/T]tatcaaactGGGGCAGCTAGAATTT
        Chromosome:
        1:149920979
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.2520/1262
        HGVS:
        NC_000001.10:g.149892872A>G, NC_000001.11:g.149920979A>C, NC_000001.11:g.149920979A>G, NC_000001.11:g.149920979A>T, NG_050966.1:g.1904T>A, NG_050966.1:g.1904T>C, NG_050966.1:g.1904T>G
        5.

        rs11177669 [Homo sapiens]
          TAGCAAGAGTGGAAATAGGAAAACC[A/C/G]GATAGGATGCAATTGCAGTGACGAG
          Chromosome:
          12:69434901
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.3125/1565
          HGVS:
          NC_000012.11:g.69828681G>A, NC_000012.12:g.69434901G>A, NC_000012.12:g.69434901G>C
          6.

          rs10958476 [Homo sapiens]
            TCAAAGCCATATAAAAGTTAATATA[C/T]GTTGACCTGATAATTCATTTAGAAA
            Chromosome:
            8:56183249
            Gene:
            PLAG1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.1320/661
            HGVS:
            NC_000008.10:g.57095808T>C, NC_000008.11:g.56183249T>C, NG_023310.1:g.33052A>G, NM_001114634.1:c.-216-12060A>G, NM_001114635.1:c.-103-12060A>G, NM_002655.2:c.-321-3736A>G, XM_011517544.2:c.-253-12060A>G, XM_017013576.1:c.-449-3736A>G, XM_017013577.1:c.-208-3736A>G
            7.

            rs10946808 [Homo sapiens]
              AAGACCTGCTTTGCCACGCGGGCCT[A/G]CAGTTGCCAGTAGGGCTAATACACC
              Chromosome:
              6:26233159
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.3666/1836
              HGVS:
              NC_000006.11:g.26233387A>G, NC_000006.12:g.26233159A>G, NG_029661.1:g.138A>G
              8.

              rs9487094 [Homo sapiens]
                CTATTTTTCAAAGAAAACTGATGCA[A/G]CACCAAGCATGTAGAGAGAATTTAT
                Chromosome:
                6:109420812
                Gene:
                PPIL6 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.4832/2420
                HGVS:
                NC_000006.11:g.109742015G>A, NC_000006.12:g.109420812G>A, NM_001111298.2:c.632-1569C>T, NM_001286360.1:c.536-1569C>T, NM_001286361.1:c.536-1569C>T, NM_173672.4:c.632-1569C>T, NR_104429.1:n.1213-1569C>T, XM_005266940.1:c.536-1569C>T, XM_011535765.2:c.536-1569C>T, XM_011535766.2:c.632-1569C>T, XM_011535767.2:c.632-1569C>T, XM_011535769.2:c.632-1569C>T, XM_017010774.1:c.632-1569C>T
                10.

                rs7846385 [Homo sapiens]
                  TGGTGGTCAGTTGGGAAAtttccag[C/T]tacagtttatctcagcactgacaat
                  Chromosome:
                  8:77247943
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.2244/1124
                  HGVS:
                  NC_000008.10:g.78160179T>C, NC_000008.11:g.77247943T>C
                  11.

                  rs7249094 [Homo sapiens]
                    GAGGCACTTGAAGGGGGGGCTGGTC[A/G]GTGTGAATTTTCAAGCCAGATTAGA
                    Chromosome:
                    19:8607115
                    Gene:
                    ADAMTS10 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.4141/2074
                    HGVS:
                    NC_000019.10:g.8607115G>A, NC_000019.9:g.8672000G>A, NG_011840.2:g.8588C>T, NM_030957.3:c.-100+1019C>T, NW_003871094.1:g.37085G>A, XM_006722917.3:c.-1208-1306C>T, XM_017027338.1:c.-99-1306C>T, XR_001753770.1:n.737+1019C>T
                    12.

                    rs7209435 [Homo sapiens]
                      TTTCTAGGAAAGATAGGGTAAGAGG[C/T]AGTGCGGGGAAGATGTTGGGGAGAG
                      Chromosome:
                      17:63635604
                      Gene:
                      MAP3K3 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.3383/1694
                      HGVS:
                      NC_000017.10:g.61712964T>C, NC_000017.11:g.63635604T>C, NM_001330431.1:c.126+2802T>C, NM_002401.3:c.126+2802T>C, NM_203351.1:c.219+803T>C, XM_005257376.1:c.219+803T>C, XM_005257376.3:c.219+803T>C, XM_005257377.1:c.126+2802T>C, XM_005257377.3:c.126+2802T>C, XM_005257378.1:c.219+803T>C, XM_005257378.2:c.219+803T>C, XR_934463.1:n.770+803T>C
                      13.

                      rs7153027 [Homo sapiens]
                        AATCTTAAACCAAACTGAAGGTCCA[A/C]CTGGAAAGGAATAGTTGAATAAAAT
                        Chromosome:
                        14:91960878
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.3960/1983
                        HGVS:
                        NC_000014.8:g.92427222A>C, NC_000014.9:g.91960878A>C
                        16.

                        rs6763931 [Homo sapiens]
                          ACAAAGCTTAAGTAATTCAGGCATG[A/G]GCATGGTTTTCTGAAAGTATAAAAC
                          Chromosome:
                          3:141383991
                          Gene:
                          ZBTB38 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.4968/2488
                          HGVS:
                          NC_000003.11:g.141102833G>A, NC_000003.12:g.141383991G>A, NG_021426.1:g.64779G>A, NM_001080412.2:c.-417+2504G>A
                          17.

                          rs6733301 [Homo sapiens]
                            ACAATGGCCTGGAAAGAAAGCATGG[A/G]CATGCCTTTCAGAGACAGGCAGACT
                            Chromosome:
                            2:25053415
                            Gene:
                            EFR3B (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.1258/630
                            HGVS:
                            NC_000002.11:g.25276284G>A, NC_000002.12:g.25053415G>A, NM_001319099.1:c.-99+10749G>A, NM_014971.1:c.7+11096G>A, XM_005264217.1:c.-99+10749G>A, XM_011532701.2:c.7+11096G>A, XR_001738675.1:n.216+11096G>A
                            19.

                            rs5751614 [Homo sapiens]
                              TGAAGTCAAGAAAGGTGAGGCATGG[A/G]CGGCCTCAGTGACCTGGACTAACTC
                              Chromosome:
                              22:23250864
                              Gene:
                              BCR (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              G=0.4327/2167
                              HGVS:
                              NC_000022.10:g.23593051G>A, NC_000022.11:g.23250864G>A, NG_009244.1:g.75500G>A, NM_004327.3:c.1280-2935G>A, NM_021574.2:c.1280-2935G>A, XR_244382.1:n.2026-2935G>A
                              20.

                              rs4800148 [Homo sapiens]
                                TGATTCTGTTCCCCCACCCCACAAC[A/G]TTCTAGGTCTTTGTTTTCATCCAGC
                                Chromosome:
                                18:23144364
                                Gene:
                                CABLES1 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                G=0.2528/1266
                                HGVS:
                                NC_000018.10:g.23144364G>A, NC_000018.9:g.20724328G>A, NM_001100619.2:c.845+7757G>A, NM_001256438.1:c.-137+9694G>A, NR_023359.1:n.88+9713G>A

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center