Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 105

1.

rs17749927 [Homo sapiens]
    TGGATCTGCTAATCTTTGTAGGGAT[A/G]GTAGATAAATGGGAAGATGTATTCA
    Chromosome:
    6:27702197
    Gene:
    LINC01012 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.0220/110
    HGVS:
    NC_000006.11:g.27669976A>G, NC_000006.12:g.27702197A>G, NR_038292.1:n.149-117A>G, NR_038293.1:n.473-117A>G, NR_038294.1:n.473-117A>G
    2.

    rs17083844 [Homo sapiens]
      CCACTATCCTCTGCATAGGAGTGCT[A/G]CTATTTTTGTCACTAAAATTATATC
      Chromosome:
      18:71175007
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.0787/394
      HGVS:
      NC_000018.10:g.71175007G>A, NC_000018.9:g.68842243G>A
      4.

      rs16891725 [Homo sapiens]
        AAAATCATTACTGGGAAAGAAAACA[C/T]CCCAAGCTGAAGTCCAAGAAAGGTA
        Chromosome:
        6:26478922
        Gene:
        LOC285819 (GeneView)
        Functional Consequence:
        nc transcript variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.1112/557
        HGVS:
        NC_000006.11:g.26479150C>T, NC_000006.12:g.26478922C>T, NR_038992.1:n.237G>A
        5.

        rs13277113 [Homo sapiens]
          AAGATTAAACACTTATCAGATCATT[A/G]TCTGCTTTTGGTTTTTCTAGTACCC
          Chromosome:
          8:11491677
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.3576/1791
          HGVS:
          NC_000008.10:g.11349186G>A, NC_000008.11:g.11491677G>A, NG_023543.1:g.2666G>A
          6.

          rs13211507 [Homo sapiens]
            caactgtgaagccccaagacatacc[C/T]atcaaaaacaataaTAGGActggac
            Chromosome:
            6:28289600
            Gene:
            PGBD1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.0300/150
            HGVS:
            NC_000006.11:g.28257377T>C, NC_000006.12:g.28289600T>C, NM_001184743.1:c.642+2432T>C, NM_032507.3:c.642+2432T>C, XM_006715228.2:c.-112+2432T>C, XM_011514942.2:c.273+2432T>C, XM_011514943.2:c.273+2432T>C, XM_011514944.2:c.-768+2432T>C, XM_017011361.1:c.642+2432T>C, XM_017011362.1:c.-112+2432T>C, XM_017011363.1:c.-768+2432T>C
            7.

            rs13197574 [Homo sapiens]
              CCCATAACAGCTGCAGCCTTGACTA[C/T]TAAATCTCAAAGGGAATAAAAAAGT
              Chromosome:
              6:28092461
              Gene:
              ZNF165 (GeneView) ZSCAN12P1 (GeneView)
              Functional Consequence:
              intron variant,nc transcript variant
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.0196/98
              HGVS:
              NC_000006.11:g.28060239T>C, NC_000006.12:g.28092461T>C, NR_024063.2:n.801T>C, XM_017011262.1:c.661+3788T>C
              9.

              rs13194781 [Homo sapiens]
                TTTTATTTTTGTTCCTAAAGTAGAG[A/G]ACTTATGGTGTCTCCAATTTGTGGC
                Chromosome:
                6:27847861
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.0206/103
                HGVS:
                NC_000006.11:g.27815639A>G, NC_000006.12:g.27847861A>G, XM_005249438.1:c.476-4248A>G, XR_241927.1:n.1399-4248A>G
                10.

                rs13194504 [Homo sapiens]
                  TCAACCCCTCTAAAAATGTCCAAGT[A/G]GAACTGTCCTGAGAAACGCTTATTC
                  Chromosome:
                  6:28662914
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.0174/87
                  HGVS:
                  NT_113891.2:g.152862A, NT_113891.2:g.152862A>G, NT_113891.3:g.152756A, NT_113891.3:g.152756A>G
                  11.

                  rs12531711 [Homo sapiens]
                    ACATTATTGTGCTCAGCATATAGTG[A/C/G]AAGTAGAGAAATCACTAAAAATTAA
                    Chromosome:
                    7:128977412
                    Gene:
                    TNPO3 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    G=0.0593/297
                    HGVS:
                    NC_000007.13:g.128617466A>G, NC_000007.14:g.128977412A>C, NC_000007.14:g.128977412A>G, NG_023428.1:g.82762T>C, NG_023428.1:g.82762T>G, NM_001191028.2:c.1870-1477T>C, NM_001191028.2:c.1870-1477T>G, NM_012470.3:c.2062-1477T>C, NM_012470.3:c.2062-1477T>G, NR_034053.2:n.2626-1477T>C, NR_034053.2:n.2626-1477T>G, XM_011515989.2:c.1864-1477T>C, XM_011515989.2:c.1864-1477T>G
                    13.

                    rs12141391 [Homo sapiens]
                      ATTTTTTTTCACAGTGGTAGACACC[A/C]AAAAAGGAATATGTGATTTTCCTCC
                      Chromosome:
                      1:71808790
                      Gene:
                      NEGR1-IT1 (GeneView) NEGR1 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      A=0.0084/42
                      HGVS:
                      NC_000001.10:g.72274473C>A, NC_000001.11:g.71808790C>A, NM_173808.2:c.410-32493G>T, NR_046218.1:n.34-10520G>T, XM_005270723.1:c.410-32493G>T, XM_011541200.2:c.410-32493G>T, XM_011541201.2:c.410-32493G>T, XM_017000961.1:c.410-32493G>T
                      14.

                      rs11574637 [Homo sapiens]
                        CGATCGCCCGCACGCTGCCGGACCT[C/T]TCCTGTGACCTTAACCTCTCCAAGC
                        Chromosome:
                        16:31357553
                        Gene:
                        ITGAX (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.2007/1005
                        HGVS:
                        NC_000016.10:g.31357553T>C, NC_000016.9:g.31368874T>C, NG_011451.1:g.7366T>C, NM_000887.4:c.430+189T>C, NM_001286375.1:c.430+189T>C, XM_005255314.1:c.430+189T>C, XM_011545852.1:c.430+189T>C, XM_011545854.1:c.430+189T>C, XR_950797.2:n.518+189T>C
                        17.

                        rs10488631 [Homo sapiens]
                          AGGCTGCTTCCATAGCTAGTCTAGC[C/T]GAACCATTTCCGAGCTACAAGGCAG
                          Chromosome:
                          7:128954129
                          Gene:
                          TNPO3 (GeneView)
                          Functional Consequence:
                          downstream variant 500B
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          C=0.0591/296
                          HGVS:
                          NC_000007.13:g.128594183T>C, NC_000007.14:g.128954129T>C, NG_023428.1:g.106045A>G, NM_001191028.2:c.*1288A>G, NM_012470.3:c.*1288A>G, NR_034053.2:n.4624A>G
                          18.

                          rs10484399 [Homo sapiens]
                            AAATAGTGAATCTACAACACCTTAA[A/G]CGCCTGATAACTTCACAATGCATGC
                            Chromosome:
                            6:27566749
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.0208/104
                            HGVS:
                            NC_000006.11:g.27534528A>G, NC_000006.12:g.27566749A>G
                            19.

                            rs9379897 [Homo sapiens]
                              GTCGTATTTACAGCTACTCTCAAAT[C/T]CCTTTTTTTTTGTGATTCCTTATAA
                              Chromosome:
                              6:26601298
                              Gene:
                              LOC105374989 (GeneView)
                              Functional Consequence:
                              upstream variant 2KB
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              C=0.1214/608
                              HGVS:
                              NC_000006.11:g.26601526T>C, NC_000006.12:g.26601298T>C, NW_004070866.1:g.15684T>C, XR_926617.2:n.-736T>C

                              Display Settings:

                              Format
                              Items per page
                              Sort by

                              Send to:

                              Choose Destination

                              Supplemental Content

                              Find related data

                              Recent activity

                              Your browsing activity is empty.

                              Activity recording is turned off.

                              Turn recording back on

                              See more...
                              Support Center