Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs16965628 [Homo sapiens]
    CACCACCATACATCCGCAACCCATT[C/G]TGCCTTTCTACTTCATACCCTAGCA
    Chromosome:
    17:30228407
    Gene:
    SLC6A4 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1494/748
    HGVS:
    NC_000017.10:g.28555425G>C, NC_000017.11:g.30228407G>C, NG_011747.2:g.12530C>G, NM_001045.5:c.-220-5492C>G, XM_005258025.1:c.-94-5492C>G
    2.

    rs25532 [Homo sapiens]
      CCAGCATCCCCCCATGCACCCCCGG[C/T]ATCCCCCCTGCACCCCTCCAGCATT
      Chromosome:
      17:30237152
      Gene:
      LOC105371720 (GeneView) SLC6A4 (GeneView)
      Functional Consequence:
      intron variant,upstream variant 2KB
      Validated:
      by 1000G,by cluster,by frequency
      HGVS:
      NC_000017.10:g.28564170G>A, NC_000017.11:g.30237152G>A, NG_011747.2:g.3785C>T, NM_001045.5:c.-1760C>T, XM_005258025.1:c.-1634C>T, XR_001752824.1:n.280+82G>A

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center