Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 7

1.

rs2227674 [Homo sapiens]
    ataccagtctgggcagcatagcaag[A/G]ccctgcctctacaaaaaaaaaattt
    Chromosome:
    7:101132927
    Gene:
    SERPINE1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.3540/1773
    HGVS:
    CM000669.2:g.101132927A>G, NC_000007.13:g.100776208A>G, NC_000007.14:g.101132927A>G, NG_013213.1:g.10830A>G, NM_000602.4:c.701-768A>G
    2.

    rs2227657 [Homo sapiens]
      ggaagaaaaTATTTAGGGTTCATAA[A/C/T]TTAAGAACAGAGAAAAATATTCTAG
      Chromosome:
      7:101130178
      Gene:
      SERPINE1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency
      Global MAF:
      T=0.1008/505
      HGVS:
      CM000669.2:g.101130178T>A, CM000669.2:g.101130178T>C, NC_000007.13:g.100773459T>C, NC_000007.14:g.101130178T>A, NC_000007.14:g.101130178T>C, NG_013213.1:g.8081T>A, NG_013213.1:g.8081T>C, NM_000602.4:c.272-243T>A, NM_000602.4:c.272-243T>C
      3.

      rs1799889 [Homo sapiens]
        ACAGAGAGAGTCTGGACACGTGGGG[A/G]GTCAGCCGTGTATCATCGGAGGCGG
        Chromosome:
        7:101126430
        Gene:
        SERPINE1 (GeneView)
        Functional Consequence:
        upstream variant 2KB
        Validated:
        by cluster
        HGVS:
        CM000669.2:g.101126430A>G, NC_000007.13:g.100769711A>G, NC_000007.14:g.101126430A>G, NG_013213.1:g.4333A>G, NM_000602.4:c.-816A>G
        4.

        rs1050813 [Homo sapiens]
          GTGTTTCTTTGTGGTCTGTGTCACC[A/G]TATCTCAGGAAGTCCAGCCACTTGA
          Chromosome:
          7:101138334
          Gene:
          SERPINE1 (GeneView)
          Functional Consequence:
          utr variant 3 prime
          Clinical significance:
          Likely benign
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency
          Global MAF:
          A=0.0823/412
          HGVS:
          CM000669.2:g.101138334G>A, NC_000007.13:g.100781615G>A, NC_000007.14:g.101138334G>A, NG_013213.1:g.16237G>A, NM_000602.4:c.*892G>A
          5.

          rs11178 [Homo sapiens]
            GTTCCCACTGAGGCCCTTTGCAGGA[C/T]GGAACTACGGGGCTTACAGGAGCTT
            Chromosome:
            7:101137803
            Gene:
            SERPINE1 (GeneView)
            Functional Consequence:
            utr variant 3 prime
            Clinical significance:
            Benign
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency
            Global MAF:
            C=0.4309/2158
            HGVS:
            CM000669.2:g.101137803T>C, NC_000007.13:g.100781084T>C, NC_000007.14:g.101137803T>C, NG_013213.1:g.15706T>C, NM_000602.4:c.*361T>C
            6.

            rs6092 [Homo sapiens]
              CCTCACCTGCCTAGTCCTGGGCCTG[A/G]CCCTTGTCTTTGGTGAAGGGTCTGC
              Chromosome:
              7:101128436
              Gene:
              SERPINE1 (GeneView)
              Functional Consequence:
              missense
              Allele Origin:
              G(germline)/A(germline)
              Clinical significance:
              other
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              A=0.0715/358
              HGVS:
              CM000669.2:g.101128436G>A, NC_000007.13:g.100771717G>A, NC_000007.14:g.101128436G>A, NG_013213.1:g.6339G>A, NM_000602.4:c.43G>A, NP_000593.1:p.Ala15Thr, XP_005250449.1:p.Ala15Thr, XP_016867749.1:p.Ala15Thr
              7.

              rs6090 [Homo sapiens]
                CTGCCTAGTCCTGGGCCTGNCCCTT[A/G]TCTTTGGTGAAGGGTCTGCTGTGCA
                Chromosome:
                7:101128442
                Gene:
                SERPINE1 (GeneView)
                Functional Consequence:
                missense
                Clinical significance:
                Likely benign
                Validated:
                by 1000G,by cluster,by frequency,by submitter
                Global MAF:
                A=0.0451/226
                HGVS:
                CM000669.2:g.101128442G>A, NC_000007.13:g.100771723G>A, NC_000007.14:g.101128442G>A, NG_013213.1:g.6345G>A, NM_000602.4:c.49G>A, NP_000593.1:p.Val17Ile, XP_005250449.1:p.Val17Ile, XP_016867749.1:p.Val17Ile

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Support Center