Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

1.

rs2241766 [Homo sapiens]
    TTCTACTGCTATTAGCTCTGCCCGG[G/T]CATGACCAGGAAACCACGACTCAAG
    Chromosome:
    3:186853103
    Gene:
    ADIPOQ-AS1 (GeneView) ADIPOQ (GeneView)
    Functional Consequence:
    nc transcript variant,synonymous codon
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.1514/758
    HGVS:
    NC_000003.11:g.186570892T>G, NC_000003.12:g.186853103T>G, NG_021140.1:g.15430T>G, NM_001177800.1:c.45T>G, NM_004797.3:c.45T>G, NP_001171271.1:p.Gly15, NP_004788.1:p.Gly15, NR_046662.1:n.2226A>C
    2.

    rs1501299 [Homo sapiens]
      TCTAGGCCTTAGTTAATAATGAATG[A/C]CTTCATATAGTTTATATCAGTGTAG
      Chromosome:
      3:186853334
      Gene:
      ADIPOQ-AS1 (GeneView) ADIPOQ (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.3003/1504
      HGVS:
      NC_000003.11:g.186571123G>T, NC_000003.12:g.186853334G>T, NG_021140.1:g.15661G>T, NM_001177800.1:c.214+62G>T, NM_004797.3:c.214+62G>T, NR_046662.1:n.2087-92C>A
      3.

      rs822396 [Homo sapiens]
        GTAGGAGAAAGAGATCTTTATTTTT[A/G]ACAAAGGGGGAGGAGCCAGAAAACT
        Chromosome:
        3:186849088
        Gene:
        ADIPOQ (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.1737/870
        HGVS:
        NC_000003.11:g.186566877G>A, NC_000003.12:g.186849088G>A, NG_021140.1:g.11415G>A, NM_001177800.1:c.-9+3481G>A, NM_004797.3:c.-8-3963G>A
        4.

        rs822395 [Homo sapiens]
          TGATCGCACCTATTAGTGGAGAAAT[A/C/G]TGTCCATAATACTGAAGTTTGGGGA
          Chromosome:
          3:186849018
          Gene:
          ADIPOQ (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          C=0.3117/1561
          HGVS:
          NC_000003.11:g.186566807C>A, NC_000003.12:g.186849018C>A, NC_000003.12:g.186849018C>G, NG_021140.1:g.11345C>A, NG_021140.1:g.11345C>G, NM_001177800.1:c.-9+3411C>A, NM_001177800.1:c.-9+3411C>G, NM_004797.3:c.-8-4033C>A, NM_004797.3:c.-8-4033C>G
          5.

          rs266729 [Homo sapiens]
            TTGCAAGAACCGGCTCAGATCCTGC[A/C/G]CTTCAAAAACAAAACATGAGCGTGC
            Chromosome:
            3:186841685
            Gene:
            ADIPOQ (GeneView)
            Functional Consequence:
            upstream variant 2KB
            Validated:
            by 1000G,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            G=0.2264/1134
            HGVS:
            NC_000003.11:g.186559474C>G, NC_000003.12:g.186841685C>A, NC_000003.12:g.186841685C>G, NG_021140.1:g.4012C>A, NG_021140.1:g.4012C>G, NM_001177800.1:c.-1124C>A, NM_001177800.1:c.-1124C>G, NM_004797.3:c.-1073C>A, NM_004797.3:c.-1073C>G

            Display Settings:

            Format
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Support Center