Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

2.
3.

rs25487 [Homo sapiens]
    CGCATGCGTCGGCGGCTGCCCTCCC[A/G]GAGGTAAGGCCTCACACGCCAACCC
    Chromosome:
    19:43551574
    Gene:
    XRCC1 (GeneView)
    Functional Consequence:
    missense
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.2604/1304
    HGVS:
    NC_000019.10:g.43551574T>C, NC_000019.9:g.44055726T>C, NG_033799.1:g.29005A>G, NM_006297.2:c.1196A>G, NP_006288.2:p.Gln399Arg

    Display Settings:

    Format
    Sort by

    Send to:

    Choose Destination

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center