Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs386833426 [Homo sapiens]
    ATAATTTATACTTTCCTTTTTTCCA[A/G]TCTCCAGCCACCACATTTGCTCAAA
    Chromosome:
    4:177438865
    Gene:
    AGA (GeneView)
    Functional Consequence:
    intron variant
    Allele Origin:
    G(unknown)/A(germline,unknown)
    Clinical significance:
    Likely pathogenic
    Validated:
    by cluster
    HGVS:
    CM000666.2:g.177438865T>C, NC_000004.11:g.178360019T>C, NC_000004.12:g.177438865T>C, NG_011845.2:g.8639A>G, NM_000027.3:c.395-8A>G, NM_001171988.1:c.395-8A>G, NR_033655.1:n.523-8A>G, XR_001741155.1:n.523-8A>G

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center