Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 43

3.

rs17125698 [Homo sapiens]
    TTTTCATTATTATTTCCAGAATATC[A/C/T]ATGGAAAAAGTCCTCAACATTTAAA
    Chromosome:
    14:89329326
    Gene:
    FOXN3 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.1915/959
    HGVS:
    NC_000014.8:g.89795670C>A, NC_000014.9:g.89329326C>A, NC_000014.9:g.89329326C>T, NM_001085471.1:c.680+21346G>A, NM_001085471.1:c.680+21346G>T, NM_005197.3:c.680+21346G>A, NM_005197.3:c.680+21346G>T, XM_005267288.1:c.680+21346G>T, XM_005267289.1:c.680+21346G>T, XM_005267290.1:c.680+21346G>T, XM_005267291.1:c.680+21346G>T
    6.

    rs12608087 [Homo sapiens]
      AGAAGAGAGAAGCAGCCCTAAAGAT[C/T]GAGGTCAGGGGAAGCTGTCCTATGT
      Chromosome:
      18:23816593
      Gene:
      LAMA3 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.2282/1143
      HGVS:
      NC_000018.10:g.23816593C>T, NC_000018.9:g.21396557C>T, NG_007853.2:g.131996C>T, NM_001127717.2:c.2147+106C>T, NM_198129.2:c.2147+106C>T, XM_011525978.2:c.2147+106C>T, XM_011525979.2:c.2147+106C>T, XM_011525980.2:c.2147+106C>T, XM_011525981.2:c.2015+106C>T, XM_011525982.2:c.2147+106C>T, XM_017025743.1:c.25+106C>T, XR_001753199.1:n.2388+106C>T
      8.

      rs11021955 [Homo sapiens]
        AGGGAAAAATCTGTCCTCAAGAAGA[C/T]ACTCTCCACCAAGGAGCTAGGAAAT
        Chromosome:
        11:11607784
        Gene:
        GALNT18 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.0735/368
        HGVS:
        NC_000011.10:g.11607784C>T, NC_000011.9:g.11629331C>T, NM_198516.2:c.235+13575G>A, XM_006718224.2:c.235+13575G>A, XM_006718225.2:c.235+13575G>A, XM_011520069.2:c.235+13575G>A, XM_011520070.2:c.235+13575G>A, XM_011520071.2:c.235+13575G>A
        9.

        rs10937823 [Homo sapiens]
          ACACGGCTTCCTGAGTGTGGGTGCC[C/T]GATCAATATTTGACCAATGAATGAG
          Chromosome:
          4:7478695
          Gene:
          SORCS2 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.1448/725
          HGVS:
          NC_000004.11:g.7480422C>T, NC_000004.12:g.7478695C>T, NM_020777.2:c.549-52835C>T, XM_005247987.1:c.99-52835C>T, XM_005247987.4:c.549-52835C>T, XM_005247988.1:c.33-52835C>T, XM_011513514.2:c.549-52835C>T, XM_011513515.2:c.549-52835C>T, XM_011513516.2:c.549-52835C>T, XM_017008481.1:c.549-52835C>T
          11.

          rs10120953 [Homo sapiens]
            tctcgatctcctgacctcgtgatcc[A/G]cccgcctcagcctcccaaagtgctg
            Chromosome:
            9:128366600
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            A=0.0286/143
            HGVS:
            NC_000009.11:g.131128879G>A, NC_000009.12:g.128366600G>A
            12.

            rs9863764 [Homo sapiens]
              TGGTTTTGATTATATCCTATCAATG[G/T]GATCTTAAAGTGATAATAATGGGAG
              Chromosome:
              3:7381807
              Gene:
              GRM7 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.2684/1344
              HGVS:
              NC_000003.11:g.7423494T>G, NC_000003.12:g.7381807T>G, NG_029781.1:g.525693T>G, NM_000844.3:c.1034-33216T>G, NM_181874.2:c.1034-33216T>G, XM_005265095.1:c.1034-33216T>G, XM_017006272.1:c.536-33216T>G, XM_017006273.1:c.536-33216T>G, XR_001740134.1:n.1326-33216T>G, XR_001740135.1:n.1326-33216T>G, XR_001740136.1:n.1326-33216T>G, XR_001740137.1:n.1326-33216T>G
              13.

              rs9525570 [Homo sapiens]
                TAAATCACTAAATCTTTTAATTAAA[C/T]GCTTGAAACTCAAACTCTGTGGTGG
                Chromosome:
                13:42100870
                Gene:
                DGKH (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.1358/680
                HGVS:
                NC_000013.10:g.42675006T>C, NC_000013.11:g.42100870T>C, NG_029191.3:g.65835T>C, NM_001204504.2:c.193-26593T>C, NM_152910.5:c.193-26593T>C, NM_178009.4:c.193-26593T>C, XM_005266270.1:c.193-26593T>C
                14.

                rs9513885 [Homo sapiens]
                  actttctgcttcagtttctctcccc[A/T]gctgtgcatccagcatgtaacttcc
                  Chromosome:
                  13:101384962
                  Gene:
                  NALCN (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by frequency,by hapmap
                  HGVS:
                  NC_000013.10:g.102037313A>T, NC_000013.11:g.101384962A>T, NM_052867.2:c.292-6309T>A, XM_005254037.1:c.292-6309T>A, XM_011521067.2:c.349-6309T>A, XM_011521068.2:c.292-6309T>A, XM_011521069.2:c.349-6309T>A, XM_017020534.1:c.292-6309T>A, XM_017020535.1:c.292-6309T>A
                  15.

                  rs9513877 [Homo sapiens]
                    cagggagatgcaaatttacattaca[A/G]gacaccatttcgtgtcatctggtgt
                    Chromosome:
                    13:101273988
                    Gene:
                    NALCN (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.2606/1305
                    HGVS:
                    NC_000013.10:g.101926339G>A, NC_000013.11:g.101273988G>A, NM_052867.2:c.1134+9945C>T, XM_005254037.1:c.1134+9945C>T, XM_011521067.2:c.1191+9945C>T, XM_011521068.2:c.1134+9945C>T, XM_011521069.2:c.1105-15414C>T, XM_017020534.1:c.1048-15414C>T, XM_017020535.1:c.1048-15414C>T, XM_017020536.1:c.687+9945C>T, XM_017020537.1:c.369+9945C>T
                    16.

                    rs9315897 [Homo sapiens]
                      TCATAAAAGAAATGTGAATAGAAAG[C/T]TATGGGATTACTGCAGAAAAAGCAG
                      Chromosome:
                      13:42164846
                      Gene:
                      DGKH (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.1284/643
                      HGVS:
                      NC_000013.10:g.42738982T>C, NC_000013.11:g.42164846T>C, NG_029191.3:g.129811T>C, NM_001204504.2:c.856-485T>C, NM_001204505.2:c.448-485T>C, NM_001204506.2:c.448-485T>C, NM_001297429.1:c.121-485T>C, NM_152910.5:c.856-485T>C, NM_178009.4:c.856-485T>C, NR_123714.1:n.580-485T>C, NR_123715.1:n.1193-485T>C, XM_005266270.1:c.856-485T>C, XM_005266271.1:c.121-485T>C
                      17.

                      rs9315885 [Homo sapiens]
                        CATTGTTCTATGAGAGGATGGTCTT[C/T]ACTTGTCTTAGTGCATTTCTTTTGT
                        Chromosome:
                        13:42068674
                        Gene:
                        DGKH (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        C=0.4147/2077
                        HGVS:
                        NC_000013.10:g.42642810C>T, NC_000013.11:g.42068674C>T, NG_002453.4:g.3305G>A, NG_029191.3:g.33639C>T, NM_001204504.2:c.192+19709C>T, NM_152910.5:c.192+19709C>T, NM_178009.4:c.192+19709C>T, XM_005266270.1:c.192+19709C>T
                        18.

                        rs7933829 [Homo sapiens]
                          CCTTGTGAGTTTCTGACATGGTCCT[C/T]CTCTGTCTCTTCCTCGCCAGCTTGG
                          Chromosome:
                          11:130672987
                          Gene:
                          C11orf44 (GeneView)
                          Functional Consequence:
                          synonymous codon
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.2616/1310
                          HGVS:
                          NC_000011.10:g.130672987C>T, NC_000011.9:g.130542882C>T, NM_001271983.1:c.9C>T, NP_001258912.1:p.Leu3
                          19.

                          rs7812884 [Homo sapiens]
                            atatgttaatttctaaaggagtatt[A/G]tcacttttaaatgaagtgataaaca
                            Chromosome:
                            8:3724407
                            Gene:
                            CSMD1 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.1194/598
                            HGVS:
                            NC_000008.10:g.3581929G>A, NC_000008.11:g.3724407G>A, NM_033225.5:c.932-15916C>T, XM_011534752.2:c.932-15916C>T, XM_017013731.1:c.932-15916C>T
                            20.

                            rs7683874 [Homo sapiens]
                              GCTGGGCGGTAGCAGGACTAGAAGG[A/G]CCTTTTGGGAGGAACTGCTCCTGGC
                              Chromosome:
                              4:7473697
                              Gene:
                              SORCS2 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.2091/1047
                              HGVS:
                              NC_000004.11:g.7475424G>A, NC_000004.12:g.7473697G>A, NM_020777.2:c.549-57833G>A, XM_005247987.1:c.99-57833G>A, XM_005247987.4:c.549-57833G>A, XM_005247988.1:c.33-57833G>A, XM_011513514.2:c.549-57833G>A, XM_011513515.2:c.549-57833G>A, XM_011513516.2:c.549-57833G>A, XM_017008481.1:c.549-57833G>A

                              Display Settings:

                              Format
                              Items per page
                              Sort by

                              Send to:

                              Choose Destination

                              Supplemental Content

                              Find related data

                              Recent activity

                              Your browsing activity is empty.

                              Activity recording is turned off.

                              Turn recording back on

                              See more...
                              Support Center