Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 22

9.
10.

rs118192173 [Homo sapiens]
    CCTGTATGGCCATGCCATCCTGCTC[C/T]GGCATGCACACAGCCGCATGGTGAG
    Chromosome:
    19:38443612
    Gene:
    RYR1 (GeneView)
    Functional Consequence:
    missense,nc transcript variant
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.0002/1
    HGVS:
    NC_000019.10:g.38443612C>T, NC_000019.9:g.38934252C>T, NG_008866.1:g.14913C>T, NM_000540.2:c.325C>T, NM_001042723.1:c.325C>T, NP_000531.2:p.Arg109Trp, NP_001036188.1:p.Arg109Trp, XM_006723317.2:c.325C>T, XM_006723319.2:c.325C>T, XM_011527205.2:c.325C>T, XP_006723380.1:p.Arg109Trp, XP_006723382.1:p.Arg109Trp, XP_011525507.1:p.Arg109Trp, XR_001753735.1:n.408C>T
    12.
    14.

    rs118192140 [Homo sapiens]
      CAGTGGGACCGACTGGTGCTCAACA[C/T]GCCGTAAGGACCCAGCCCCCACCTC
      Chromosome:
      19:38573304
      Gene:
      RYR1 (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      T(unknown)/C(germline,unknown)
      Clinical significance:
      Pathogenic
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      T=0.0002/1
      HGVS:
      NC_000019.10:g.38573304C>T, NC_000019.9:g.39063944C>T, NG_008866.1:g.144605C>T, NM_000540.2:c.14126C>T, NM_001042723.1:c.14111C>T, NP_000531.2:p.Thr4709Met, NP_001036188.1:p.Thr4704Met, XM_006723317.2:c.14108C>T, XM_006723319.2:c.14093C>T, XM_011527205.2:c.14039C>T, XP_006723380.1:p.Thr4703Met, XP_006723382.1:p.Thr4698Met, XP_011525507.1:p.Thr4680Met
      15.
      17.
      18.
      19.
      20.

      Display Settings:

      Format
      Items per page
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center