Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs4658971 [Homo sapiens]
    ATGGAGGCGTTCCACCAGTGCAGAG[C/T]GGTAATTACGCTGCCCGGTCTCACT
    Chromosome:
    1:231972068
    Gene:
    DISC1 (GeneView) TSNAX-DISC1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1903/953
    HGVS:
    NC_000001.10:g.232107814C>T, NC_000001.11:g.231972068C>T, NG_011681.1:g.350254C>T, NM_001012957.1:c.2042+13180C>T, NM_001164537.1:c.2138+13180C>T, NM_001164538.1:c.2042+13180C>T, NM_001164540.1:c.1676+13180C>T, NM_001164541.1:c.1982-36717C>T, NM_001164547.1:c.*15+13180C>T, NM_018662.2:c.2042+13180C>T, NR_028393.1:n.2708+13180C>T
    2.

    rs843979 [Homo sapiens]
      ATGGATAGCAACCCCTCCCTGGATT[C/G]TTAGTTAGAAGGTGATGAGATTAAG
      Chromosome:
      1:231994862
      Gene:
      DISC1 (GeneView) TSNAX-DISC1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      G=0.4551/2279
      HGVS:
      NC_000001.10:g.232130608C>G, NC_000001.11:g.231994862C>G, NG_011681.1:g.373048C>G, NM_001012957.1:c.2043-13923C>G, NM_001164537.1:c.2139-13923C>G, NM_001164538.1:c.2043-13923C>G, NM_001164540.1:c.1677-13923C>G, NM_001164541.1:c.1982-13923C>G, NM_001164547.1:c.*16-13923C>G, NM_018662.2:c.2043-13923C>G, NR_028393.1:n.2709-13923C>G
      3.

      rs821616 [Homo sapiens]
        CCCCTGGCTTCCTGGAGCTGTAGGC[A/T]CTGGATAAGCAATCGACAAGCTTCC
        Chromosome:
        1:232008852
        Gene:
        DISC1 (GeneView) TSNAX-DISC1 (GeneView)
        Functional Consequence:
        missense,nc transcript variant,utr variant 3 prime
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        T=0.2502/1253
        HGVS:
        NC_000001.10:g.232144598A>T, NC_000001.11:g.232008852A>T, NG_011681.1:g.387038A>T, NM_001012957.1:c.2110A>T, NM_001164537.1:c.2206A>T, NM_001164538.1:c.2110A>T, NM_001164540.1:c.1744A>T, NM_001164541.1:c.2049A>T, NM_001164547.1:c.*83A>T, NM_018662.2:c.2110A>T, NP_001012975.1:p.Ser704Cys, NP_001158009.1:p.Ser736Cys, NP_001158010.1:p.Ser704Cys, NP_001158012.1:p.Ser582Cys, NP_001158013.1:p.Arg683Ser, NP_061132.2:p.Ser704Cys, NR_028393.1:n.2776A>T
        4.

        rs821597 [Homo sapiens]
          GTTTGCCATCAGGCAATAATGAATT[C/T]CTCCTGTACAATGGTTAGAGATATA
          Chromosome:
          1:231966518
          Gene:
          DISC1 (GeneView) TSNAX-DISC1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          G=0.4792/2400
          HGVS:
          NC_000001.10:g.232102264G>A, NC_000001.11:g.231966518G>A, NG_011681.1:g.344704G>A, NM_001012957.1:c.2042+7630G>A, NM_001164537.1:c.2138+7630G>A, NM_001164538.1:c.2042+7630G>A, NM_001164540.1:c.1676+7630G>A, NM_001164541.1:c.1982-42267G>A, NM_001164547.1:c.*15+7630G>A, NM_018662.2:c.2042+7630G>A, NR_028393.1:n.2708+7630G>A

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center