Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs5029930 [Homo sapiens]
    CCATCTGATCCAGAGAATGACTCCC[A/C]CTATGCCTTTCCCAGCAATCAGATT
    Chromosome:
    6:137869547
    Gene:
    LOC100130476 (GeneView) TNFAIP3 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.2059/1031
    HGVS:
    NC_000006.11:g.138190684A>C, NC_000006.12:g.137869547A>C, NG_032761.1:g.7104A>C, NM_001270507.1:c.-15-1666A>C, NM_001270508.1:c.-15-1666A>C, NM_006290.3:c.-15-1666A>C, NR_049793.1:n.-1314T>G, XM_005267119.1:c.-1577A>C, XM_006715555.1:c.-2332A>C, XM_011536095.1:c.-15-1666A>C, XM_011536096.1:c.-15-1666A>C
    2.

    rs610604 [Homo sapiens]
      AAATGCAGGCCTGTGATGAAGAGCT[A/C]ACACTTTTCACGCAACATGATCTGA
      Chromosome:
      6:137878280
      Gene:
      TNFAIP3 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      G=0.3866/1936
      HGVS:
      NC_000006.11:g.138199417G>T, NC_000006.12:g.137878280G>T, NG_032761.1:g.15837G>T, NM_001270507.1:c.987-152G>T, NM_001270508.1:c.987-152G>T, NM_006290.3:c.987-152G>T, XM_005267119.1:c.987-152G>T, XM_006715555.1:c.348-152G>T, XM_011536095.1:c.987-152G>T, XM_011536096.1:c.987-152G>T

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center