Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 20

1.

rs10514971 [Homo sapiens]
    CAGTAACAAAATTTGTGAAAGCACA[C/T]CCTAATCATGTTATTTCTTCAATCA
    Chromosome:
    17:49661184
    Gene:
    SPOP (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1174/588
    HGVS:
    NC_000017.10:g.47738546C>T, NC_000017.11:g.49661184C>T, NG_041815.1:g.21980G>A, NM_001007226.1:c.-67+6843G>A, NM_001007227.1:c.-67+6843G>A, NM_001007228.1:c.-67+16749G>A, NM_001007229.1:c.-118+16749G>A, NM_001007230.1:c.-118+6843G>A, NM_003563.3:c.-67+14711G>A, XM_005257722.1:c.-118+14711G>A
    2.

    rs10507342 [Homo sapiens]
      AGGAAAAACACATATTCTTCAGAAA[C/T]GCAATTGATATCTAACTTTAGAAAT
      Chromosome:
      13:25045592
      Gene:
      LOC105370119 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.0729/365
      HGVS:
      NC_000013.10:g.25619730T>C, NC_000013.11:g.25045592T>C, XR_001749796.1:n.1291+94A>G, XR_941760.2:n.1291+94A>G
      3.

      rs10506536 [Homo sapiens]
        CAACTGACCACTAATCTAACATATA[A/T]CTAGGCATTTATCTTGTTTTTGTTT
        Chromosome:
        12:64662602
        Gene:
        RASSF3 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.0665/333
        HGVS:
        NC_000012.11:g.65056382A>T, NC_000012.12:g.64662602A>T, NM_178169.3:c.112-22185A>T, NR_040718.1:n.232-22185A>T, XM_006719345.3:c.81+13050A>T, XM_011538195.2:c.76-22185A>T
        4.

        rs10499339 [Homo sapiens]
          TTCATATAAAACATCATTTAAAATC[A/C/G]TCTATCCATATGGAACACATTACGT
          Chromosome:
          7:3491977
          Gene:
          SDK1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.1320/661
          HGVS:
          NC_000007.13:g.3531609G>C, NC_000007.14:g.3491977G>A, NC_000007.14:g.3491977G>C, NG_051298.1:g.195530G>A, NG_051298.1:g.195530G>C, NM_152744.3:c.299-127103G>A, NM_152744.3:c.299-127103G>C
          5.

          rs10492198 [Homo sapiens]
            CACTATACTTGCCTAGGTAACTAAC[A/G]CATGGATTATACATTTTAATGTGTG
            Chromosome:
            12:68100048
            Gene:
            LOC107984526 (GeneView)
            Functional Consequence:
            intron variant,nc transcript variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.3496/1751
            HGVS:
            NC_000012.11:g.68493828C>T, NC_000012.12:g.68100048C>T, XR_001749190.1:n.3361G>A, XR_001749191.1:n.4638-4077G>A, XR_001749192.1:n.2543+818G>A
            6.

            rs10490220 [Homo sapiens]
              AACTCTGCAGAAGGGCTCTTATTTT[C/G]CTCATACTGCAATTAGTGAGCGTCC
              Chromosome:
              2:50718639
              Gene:
              NRXN1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.0497/249
              HGVS:
              NC_000002.11:g.50945777G>C, NC_000002.12:g.50718639G>C, NG_011878.1:g.318898C>G, NM_001135659.2:c.932-95024C>G, NM_001330077.1:c.833-95024C>G, NM_001330078.1:c.833-95024C>G, NM_001330082.1:c.833-95024C>G, NM_001330083.1:c.773-95024C>G, NM_001330084.1:c.773-95024C>G, NM_001330085.1:c.833-95024C>G, NM_001330086.1:c.833-95024C>G, NM_001330087.1:c.773-95024C>G, NM_001330088.1:c.803-95024C>G, NM_001330093.1:c.830-95024C>G, NM_001330094.1:c.821-95024C>G, NM_001330095.1:c.833-95024C>G, NM_001330096.1:c.773-95024C>G, NM_004801.5:c.833-95024C>G, XM_005264642.1:c.833-95024C>G, XM_005264642.3:c.833-95024C>G, XM_005264643.1:c.833-95024C>G, XM_005264643.3:c.833-95024C>G, XM_006712137.3:c.833-95024C>G, XM_006712140.3:c.833-95024C>G, XM_011533167.2:c.833-95024C>G, XM_011533171.2:c.833-95024C>G, XM_011533172.2:c.833-95024C>G, XM_011533174.2:c.833-95024C>G, XM_011533175.2:c.821-95024C>G, XM_011533177.2:c.833-95024C>G, XM_011533178.2:c.815-95024C>G, XM_011533180.2:c.833-95024C>G, XM_017005303.1:c.833-95024C>G, XM_017005304.1:c.830-95024C>G, XM_017005305.1:c.833-95024C>G, XM_017005306.1:c.821-95024C>G, XM_017005307.1:c.815-95024C>G, XM_017005308.1:c.833-95024C>G, XM_017005309.1:c.833-95024C>G, XM_017005310.1:c.803-95024C>G, XM_017005311.1:c.833-95024C>G, XM_017005312.1:c.830-95024C>G, XM_017005313.1:c.833-95024C>G, XM_017005314.1:c.773-95024C>G, XM_017005315.1:c.833-95024C>G, XM_017005316.1:c.815-95024C>G, XM_017005317.1:c.821-95024C>G, XM_017005318.1:c.833-95024C>G, XM_017005319.1:c.833-95024C>G, XM_017005320.1:c.833-95024C>G, XM_017005321.1:c.833-95024C>G, XM_017005322.1:c.833-95024C>G, XM_017005323.1:c.773-95024C>G, XM_017005324.1:c.833-95024C>G, XM_017005325.1:c.833-95024C>G, XM_017005326.1:c.815-95024C>G, XM_017005327.1:c.833-95024C>G, XM_017005328.1:c.833-95024C>G, XM_017005329.1:c.833-95024C>G, XM_017005330.1:c.773-95024C>G, XM_017005331.1:c.803-95024C>G, XM_017005332.1:c.773-95024C>G, XM_017005333.1:c.773-95024C>G
              7.

              rs10484227 [Homo sapiens]
                TGATGCCACTGTGCCAACAGGAATT[A/G]TGGGCTCTGTATAATATTGCTTCCT
                Chromosome:
                14:20046864
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.0779/390
                HGVS:
                NC_000014.8:g.20515023G>A, NC_000014.9:g.20046864G>A
                8.

                rs10483256 [Homo sapiens]
                  TATGACTGTCAGATATTGGACCAAG[A/G]ATAGTTTTATAAGTCACATAGTCTG
                  Chromosome:
                  14:21669882
                  Gene:
                  OR4E1 (GeneView)
                  Functional Consequence:
                  downstream variant 500B
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.1386/694
                  HGVS:
                  NC_000014.8:g.22138095G>A, NC_000014.9:g.21669882G>A, NG_001332.3:g.47979G>A, NM_001317107.1:c.*106C>T
                  9.

                  rs10483251 [Homo sapiens]
                    AGGGAAAAAGTTATGTGACCAGATT[C/G/T]TACCTTAATTGTGGGTGGGATATTC
                    Chromosome:
                    14:21203118
                    Gene:
                    LINC00641 (GeneView)
                    Functional Consequence:
                    intron variant,nc transcript variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    T=0.2055/1029
                    HGVS:
                    NC_000014.8:g.21671277G>T, NC_000014.9:g.21203118G>C, NC_000014.9:g.21203118G>T, NR_038970.1:n.2386C>A, NR_038970.1:n.2386C>G, NR_038971.1:n.291-1185C>A, NR_038971.1:n.291-1185C>G
                    10.

                    rs10483135 [Homo sapiens]
                      TGAGGGATTGTGGCTGTTGATGTCA[A/C]GACTGGCGTTTACCTTAGGCCTGAG
                      Chromosome:
                      22:27418249
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.0146/73
                      HGVS:
                      NC_000022.10:g.27814210A>C, NC_000022.11:g.27418249A>C
                      11.

                      rs9322978 [Homo sapiens]
                        GGCAGATGAAGTCAAGGTCCACTCA[A/T]ATCAGAATGTCCCAACAGGTAGGTC
                        Chromosome:
                        14:21380742
                        Gene:
                        SUPT16H (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.2021/1012
                        HGVS:
                        NC_000014.8:g.21848901T>A, NC_000014.9:g.21380742T>A, NG_009932.1:g.8525A>T, NM_007192.3:c.66+3120A>T, XM_011536381.2:c.-379+3120A>T
                        12.

                        rs8081154 [Homo sapiens]
                          ATAAATAATCCTAAAAACTGAATGT[A/T]AAGTAGACATGGAGCTTTCATGGGC
                          Chromosome:
                          17:50763678
                          Gene:
                          LINC00483 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.3746/1876
                          HGVS:
                          NC_000017.10:g.48841039T>A, NC_000017.11:g.50763678T>A, NR_073199.1:n.192-121A>T, XR_243667.1:n.2004A>T, XR_243668.1:n.541-121A>T, XR_243669.1:n.234-121A>T
                          13.

                          rs6005907 [Homo sapiens]
                            GAGTGGGTTCCCACTGTGAGCCGTC[A/G]TAATCTGGAGTAGGGTTGTGGAGTT
                            Chromosome:
                            22:28831983
                            Gene:
                            ZNRF3 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.1663/833
                            HGVS:
                            NC_000022.10:g.29227971G>A, NC_000022.11:g.28831983G>A, XM_011530435.2:c.15+9804G>A, XM_011530436.2:c.15+9804G>A, XM_011530437.1:c.15+9804G>A, XM_011530438.2:c.15+9804G>A, XM_017028990.1:c.15+9804G>A
                            14.

                            rs3929856 [Homo sapiens]
                              TTCTGCACCCTACTGTGGCATTACT[C/T]TTTCAGGGAGCTCATTGAGCTCCAC
                              Chromosome:
                              13:19394916
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              C=0.3031/1518
                              HGVS:
                              NC_000013.10:g.19969056T>C, NC_000013.11:g.19394916T>C, NG_011399.2:g.45886T>C
                              15.

                              rs2239318 [Homo sapiens]
                                ATCTTCAGAAACTCACAATAAGGTA[C/T]ATTTCATCTTAACTAAGGTAAGACA
                                Chromosome:
                                16:3874936
                                Gene:
                                CREBBP (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                T=0.0996/499
                                HGVS:
                                NC_000016.10:g.3874936C>T, NC_000016.9:g.3924937C>T, NG_009873.1:g.10185G>A, NM_001079846.1:c.85+4896G>A, NM_004380.2:c.85+4896G>A, XM_005255124.1:c.85+4896G>A, XM_005255124.4:c.85+4896G>A, XM_005255125.1:c.85+4896G>A, XM_005255125.4:c.85+4896G>A, XM_006720848.3:c.85+4896G>A, XM_011522382.2:c.85+4896G>A, XM_017022944.1:c.85+4896G>A
                                16.

                                rs2193411 [Homo sapiens]
                                  cccagggcggactgccttttaaggt[C/T]tgtcagctgtggggcaagtgggcca
                                  Chromosome:
                                  2:51040002
                                  Gene:
                                  LOC730100 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  T=0.1777/890
                                  HGVS:
                                  NC_000002.11:g.51267140C>T, NC_000002.12:g.51040002C>T, NR_135237.1:n.416+6986C>T, XR_245003.1:n.416+6986C>T
                                  17.

                                  rs1586340 [Homo sapiens]
                                    agggactgtagcttaaaaataactg[A/G]aactcagaccatattaaccagattc
                                    Chromosome:
                                    4:91936104
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    C=0.2085/1044
                                    HGVS:
                                    NC_000004.11:g.92857255T>C, NC_000004.12:g.91936104T>C
                                    19.

                                    rs1493182 [Homo sapiens]
                                      ATCCAGAAAATAAAAGAATTATCCA[A/G]GAACAGTACGCCAGGGAAAATTCTT
                                      Chromosome:
                                      4:80868416
                                      Gene:
                                      C4orf22 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      T=0.4335/2171
                                      HGVS:
                                      NC_000004.11:g.81789570C>T, NC_000004.12:g.80868416C>T, NM_001206997.1:c.385-1577C>T, NM_152770.2:c.334-1577C>T, XM_005262883.1:c.334-1577C>T, XM_005262884.1:c.334-95101C>T, XM_017007972.1:c.388-1577C>T, XM_017007973.1:c.388-1577C>T, XM_017007974.1:c.388-1577C>T, XM_017007975.1:c.151-1577C>T, XM_017007978.1:c.94-1577C>T, XR_244623.1:n.514-1577C>T
                                      20.

                                      rs1368052 [Homo sapiens]
                                        GGCGAAACCAATCTTGTATTTGTAT[G/T]CAAGATAGCAGTTACATAGCTTTTC
                                        Chromosome:
                                        7:7128062
                                        Validated:
                                        by 1000G,by cluster,by frequency,by hapmap
                                        Global MAF:
                                        A=0.0365/183
                                        HGVS:
                                        NC_000007.13:g.7167693C>A, NC_000007.14:g.7128062C>A

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center