Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 30

1.

rs16878206 [Homo sapiens]
    AGTGCTGTTTAGAAGAAGCTGGTGA[C/T]GGAGGTCTGCTTAGGAATGAGTGCA
    Chromosome:
    5:60520967
    Gene:
    LOC107986349 (GeneView) PART1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.3488/1747
    HGVS:
    NC_000005.10:g.60520967A>G, NC_000005.9:g.59816794A>G, NR_024617.1:n.712-8437A>G, NR_028509.1:n.493-53A>G, XR_001742412.1:n.2202+1084T>C
    2.

    rs12188950 [Homo sapiens]
      CCATCATTTTACATTTCTCCTGTTA[C/T]TGTGCCCTATCTGCTGTGTACCCCT
      Chromosome:
      5:60487490
      Gene:
      PART1 (GeneView) PDE4D (GeneView)
      Functional Consequence:
      intron variant,upstream variant 2KB
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.0883/442
      HGVS:
      NC_000005.10:g.60487490C>T, NC_000005.9:g.59783317C>T, NG_027957.1:g.5609G>A, NM_001165899.1:c.-90+452G>A, NR_024617.1:n.-223C>T, NR_028508.1:n.-442C>T, NR_028509.1:n.-442C>T, XM_017009566.1:c.-139+452G>A, XM_017009568.1:c.-193+452G>A, XM_017009571.1:c.-674+452G>A
      3.

      rs6875372 [Homo sapiens]
        CATGACTACATTTATAAATGAGTTC[A/T]GTATCAGGCTGGATGGAAATTCTGT
        Chromosome:
        5:64783188
        Gene:
        CWC27 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.3620/1813
        HGVS:
        NC_000005.10:g.64783188T>A, NC_000005.9:g.64079015T>A, NM_001297644.1:c.253-648T>A, NM_001297645.1:c.253-648T>A, NM_001318000.1:c.253-648T>A, NM_005869.3:c.253-648T>A, XM_005248399.1:c.253-648T>A, XM_011543095.2:c.253-648T>A, XM_011543096.1:c.253-648T>A, XM_017008943.1:c.253-648T>A
        4.

        rs4133470 [Homo sapiens]
          ACACTTCATTATTTTTAGTGGCAGC[A/G]TGGTTCTGATGAGCACACCGTCGGT
          Chromosome:
          5:60522419
          Gene:
          LOC107986349 (GeneView) PART1 (GeneView)
          Functional Consequence:
          intron variant,nc transcript variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.3530/1768
          HGVS:
          NC_000005.10:g.60522419T>C, NC_000005.9:g.59818246T>C, NR_024617.1:n.712-6985T>C, NR_028509.1:n.1892T>C, XR_001742412.1:n.1834A>G
          5.

          rs3887175 [Homo sapiens]
            AAAGATTTAGTTGATGGGAGGGAGG[A/T]TAGGCCCCTTTGTGGGCCACAAAGA
            Chromosome:
            5:60494629
            Gene:
            PART1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.1034/518
            HGVS:
            NC_000005.10:g.60494629A>T, NC_000005.9:g.59790456A>T, NR_024617.1:n.711+6206A>T, NR_028509.1:n.492+6206A>T
            6.

            rs3756739 [Homo sapiens]
              CGCCGCTTTGACTGTGCCTTGTTCT[C/G]ACAGCTGGCGGGAAGCAAGCGCCTT
              Chromosome:
              5:64768584
              Gene:
              CWC27 (GeneView) SREK1IP1 (GeneView)
              Functional Consequence:
              upstream variant 2KB,utr variant 5 prime
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.2422/1213
              HGVS:
              NC_000005.10:g.64768584G>C, NC_000005.9:g.64064411G>C, NM_001297644.1:c.-563G>C, NM_001297645.1:c.-563G>C, NM_001318000.1:c.-563G>C, NM_005869.3:c.-563G>C, NM_173829.3:c.-67C>G, XM_005248399.1:c.-563G>C, XM_011543095.2:c.-563G>C, XM_011543096.1:c.-563G>C, XM_011543344.2:c.-67C>G, XM_017008943.1:c.-563G>C
              7.

              rs2910829 [Homo sapiens]
                CTGGACATTCATAACATCTACACAA[C/T]ATTTCCCAAACTAGATGCATCCATT
                Chromosome:
                5:60174072
                Gene:
                PDE4D (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                A=0.4233/2120
                HGVS:
                NC_000005.10:g.60174072G>A, NC_000005.9:g.59469899G>A, NG_027957.1:g.319027C>T, NM_001165899.1:c.42+11485C>T, XM_011543469.1:c.42+11485C>T, XM_011543470.2:c.42+11485C>T, XM_011543471.1:c.42+11485C>T, XM_011543473.1:c.42+11485C>T, XM_011543477.2:c.-290+11485C>T, XM_017009565.1:c.42+11485C>T, XM_017009566.1:c.42+11485C>T, XM_017009568.1:c.-62+11485C>T, XM_017009571.1:c.-543+11485C>T
                9.
                11.

                rs966221 [Homo sapiens]
                  CATCATTTTAGGATAGATAGTAAAA[C/T]GTGGTTTATCCAGCAGCAGATCCTT
                  Chromosome:
                  5:60206693
                  Gene:
                  PDE4D (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.4688/2348
                  HGVS:
                  NC_000005.10:g.60206693A>G, NC_000005.9:g.59502520A>G, NG_027957.1:g.286406T>C, NM_001165899.1:c.-89-21006T>C, XM_011543469.1:c.-89-21006T>C, XM_011543473.1:c.-89-21006T>C, XM_017009565.1:c.-89-21006T>C, XM_017009566.1:c.-89-21006T>C, XM_017009568.1:c.-192-21006T>C, XM_017009571.1:c.-673-21006T>C
                  13.

                  rs918592 [Homo sapiens]
                    TTTTTTAACATAAGGGCAGGAGGGT[A/G]TGCACACTCCAGAGATGTGTGTCAT
                    Chromosome:
                    5:60401476
                    Gene:
                    PDE4D (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    T=0.4754/2381
                    HGVS:
                    NC_000005.10:g.60401476C>T, NC_000005.9:g.59697303C>T, NG_027957.1:g.91623G>A, NM_001165899.1:c.-90+86466G>A, XM_011543473.1:c.-90+47161G>A, XM_017009566.1:c.-138-66346G>A, XM_017009568.1:c.-193+86466G>A, XM_017009571.1:c.-674+86466G>A
                    14.

                    rs918590 [Homo sapiens]
                      GATTGGAGTTATAATCTGTGTTTTC[G/T]TTCCCATTTTTGGGTATTCACATTT
                      Chromosome:
                      5:60401981
                      Gene:
                      PDE4D (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      C=0.4287/2147
                      HGVS:
                      NC_000005.10:g.60401981A>C, NC_000005.9:g.59697808A>C, NG_027957.1:g.91118T>G, NM_001165899.1:c.-90+85961T>G, XM_011543473.1:c.-90+46656T>G, XM_017009566.1:c.-138-66851T>G, XM_017009568.1:c.-193+85961T>G, XM_017009571.1:c.-674+85961T>G
                      15.

                      rs918582 [Homo sapiens]
                        ccttactagcatatccatcacctca[A/G]atatttatcatttatttgtggtgaa
                        Chromosome:
                        5:58882943
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency
                        Global MAF:
                        A=0.3806/1906
                        HGVS:
                        NC_000005.10:g.58882943G>A, NC_000005.9:g.58178770G>A
                        16.

                        rs878567 [Homo sapiens]
                          CCTGTATCATCAGTTTTGATCCCAG[C/T]AATTGCCTCTTCTCTCTTCTATCTC
                          Chromosome:
                          5:63960164
                          Gene:
                          HTR1A (GeneView)
                          Functional Consequence:
                          utr variant 3 prime
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.3522/1764
                          HGVS:
                          NC_000005.10:g.63960164A>G, NC_000005.9:g.63255991A>G, NG_032816.1:g.7129T>C, NM_000524.3:c.*287T>C
                          17.

                          rs702553 [Homo sapiens]
                            agtctagcttcagagtacatgttAA[A/T]CATGTAGGAAATTAACCATTATCAC
                            Chromosome:
                            5:60440946
                            Gene:
                            PDE4D (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            T=0.4744/2376
                            HGVS:
                            NC_000005.10:g.60440946A>T, NC_000005.9:g.59736773A>T, NG_027957.1:g.52153T>A, NM_001165899.1:c.-90+46996T>A, XM_011543473.1:c.-90+7691T>A, XM_017009566.1:c.-139+46996T>A, XM_017009568.1:c.-193+46996T>A, XM_017009571.1:c.-674+46996T>A
                            19.

                            rs456009 [Homo sapiens]
                              GATATAATTAACTCCTCTAACAGCT[A/G]AGGCAACTGAGGCTGAAATAGATTA
                              Chromosome:
                              5:60500907
                              Gene:
                              PART1 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency
                              Global MAF:
                              A=0.4203/2105
                              HGVS:
                              NC_000005.10:g.60500907G>A, NC_000005.9:g.59796734G>A, NR_024617.1:n.711+12484G>A, NR_028509.1:n.492+12484G>A

                              Display Settings:

                              Format
                              Items per page
                              Sort by

                              Send to:

                              Choose Destination

                              Supplemental Content

                              Find related data

                              Recent activity

                              Your browsing activity is empty.

                              Activity recording is turned off.

                              Turn recording back on

                              See more...
                              Support Center