Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs2275163 [Homo sapiens]
    CAGAAACCTACATTAGAGCAAAAGT[C/T]TAAGTGGATATTGTGCTGTGAGCAG
    Chromosome:
    1:241566754
    Gene:
    KMO (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.2776/1390
    HGVS:
    NC_000001.10:g.241730054C>T, NC_000001.11:g.241566754C>T, NM_003679.4:c.809+142C>T, XM_005273337.1:c.929+142C>T, XM_005273338.1:c.566+142C>T, XM_005273338.3:c.566+142C>T, XM_017002649.1:c.566+142C>T, XM_017002650.1:c.566+142C>T

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center