Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 16

1.

rs9576135 [Homo sapiens]
    GGACAGCCAGTCCCATGAGATCCCC[A/G]GCAGGCTGCCTGCCTTTCAGATCCT
    Chromosome:
    13:36908022
    Gene:
    SMAD9 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.4657/2332
    HGVS:
    NC_000013.10:g.37482159A>G, NC_000013.11:g.36908022A>G, NG_016963.1:g.17251T>C, NM_001127217.2:c.-187+12094T>C, NM_005905.5:c.-187+12094T>C, XM_005266403.1:c.-187+12094T>C, XM_005266403.3:c.-187+12094T>C, XM_005266404.1:c.-187+12094T>C, XM_005266404.3:c.-187+12094T>C, XM_006719827.3:c.-187+12613T>C
    2.

    rs8036023 [Homo sapiens]
      AGAGGGCAGCTAGAATAGTCAGTCA[C/G]TGGTAGTGAAGAGGCTCAGGTGCTG
      Chromosome:
      15:66438947
      Gene:
      MAP2K1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.3201/1603
      HGVS:
      NC_000015.10:g.66438947G>C, NC_000015.9:g.66731285G>C, NG_008305.1:g.57075G>C, NM_002755.3:c.438+2055G>C, XM_005254540.1:c.372+2055G>C, XM_005254541.1:c.438+2055G>C, XM_011521783.2:c.372+2055G>C, XM_017022411.1:c.438+2055G>C, XM_017022412.1:c.372+2055G>C
      4.

      rs2149860 [Homo sapiens]
        ATCCAAAAAACATATTAGATAGGCC[A/G]ATTTTGAGGGCATTTATTTGTAGAG
        Chromosome:
        13:33054852
        Gene:
        KL (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.4447/2227
        HGVS:
        NC_000013.10:g.33628989A>G, NC_000013.11:g.33054852A>G, NG_011485.1:g.43419A>G, NM_004795.3:c.1331-195A>G, XM_006719895.2:c.410-195A>G
        5.

        rs2038931 [Homo sapiens]
          TGCTGTCTGATAAAAGGCCACAGGA[C/T]AGCTGTGCAGGTAGAGCTGGTGAAG
          Chromosome:
          1:91708858
          Gene:
          TGFBR3 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          A=0.2047/1025
          HGVS:
          NC_000001.10:g.92174415G>A, NC_000001.11:g.91708858G>A, NG_027757.1:g.202145C>T, NM_001195683.1:c.2164-75C>T, NM_001195684.1:c.2164-75C>T, NM_003243.4:c.2167-75C>T, NR_036634.1:n.2779-75C>T, XM_006710867.2:c.2167-75C>T, XM_006710868.2:c.2167-75C>T
          6.
          7.

          rs1019856 [Homo sapiens]
            CTTGTGGTGTGATATGTAGGTATCC[A/G]AATGCTCAGTTTATGCACCACAGTC
            Chromosome:
            3:30655324
            Gene:
            LOC105377016 (GeneView) TGFBR2 (GeneView)
            Functional Consequence:
            intron variant,nc transcript variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            T=0.1408/705
            HGVS:
            NC_000003.11:g.30696816T>C, NC_000003.12:g.30655324T>C, NG_007490.1:g.53823T>C, NM_001024847.2:c.529+4864T>C, NM_003242.5:c.454+4864T>C, XM_011534043.2:c.481+4864T>C, XM_011534045.2:c.349+4864T>C, XM_017007106.1:c.349+4864T>C, XR_001740630.1:n.1345T>C, XR_001740631.1:n.646+2220T>C
            8.

            rs736839 [Homo sapiens]
              CCCGTGTCCACACCCAGCACACTCC[C/T]GGCTTCAAATGCCCCAAAGGTCACA
              Chromosome:
              18:49001695
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              T=0.3255/1630
              HGVS:
              NC_000018.10:g.49001695C>T, NC_000018.9:g.46528065C>T
              9.

              rs685417 [Homo sapiens]
                AGAGAAGCAGAAGAACATAATAAAT[A/G]CCCACTGTCCTACTCAATAGAGACT
                Chromosome:
                13:33038995
                Gene:
                KL (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                G=0.4111/2059
                HGVS:
                NC_000013.10:g.33613132G>A, NC_000013.11:g.33038995G>A, NG_011485.1:g.27562G>A, NM_004795.3:c.820-14772G>A, XM_006719895.2:c.-102-14772G>A
                10.

                rs603085 [Homo sapiens]
                  TATAATTAAGCTTACAGAAAGCACA[C/T]GGAAATAGGAACCTACCAGGATGTG
                  Chromosome:
                  9:27123262
                  Gene:
                  TEK (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  G=0.2961/1483
                  HGVS:
                  NC_000009.11:g.27123260A>G, NC_000009.12:g.27123262A>G, NG_011828.1:g.19114A>G, NM_000459.4:c.52+13620A>G, NM_001290077.1:c.52+13620A>G, NM_001290078.1:c.52+13620A>G, XM_005251561.1:c.52+13620A>G, XM_005251562.1:c.52+13620A>G, XM_005251563.1:c.52+13620A>G
                  11.

                  rs516306 [Homo sapiens]
                    GAGAGCCCAGTCCCACCCATGAACT[A/G]TACAGTAATCTTTACATACTTTTTA
                    Chromosome:
                    13:33026139
                    Gene:
                    KL (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    C=0.2464/1234
                    HGVS:
                    NC_000013.10:g.33600277T>C, NC_000013.11:g.33026139T>C, NG_011485.1:g.14707T>C, NM_004795.3:c.819+8880T>C, XM_006719895.2:c.-103+9826T>C
                    12.

                    rs276789 [Homo sapiens]
                      gattggaatgcagtggggtgaaatg[A/G]aattgaatggaatggagtggagtgg
                      Chromosome:
                      21:7954268
                      Validated:
                      no info
                      HGVS:
                      NC_000021.9:g.7954268T>C
                      13.

                      rs270393 [Homo sapiens]
                        ATATGTGTTCACCATTCTTATTTTT[C/G]CCCCGTTCTTATTGACTGTAGTGGT
                        Chromosome:
                        6:7768619
                        Gene:
                        BMP6 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        G=0.3746/1876
                        HGVS:
                        NC_000006.11:g.7768852G>C, NC_000006.12:g.7768619G>C, NM_001718.5:c.664+41000G>C, XM_005249305.1:c.430+41000G>C
                        14.

                        rs219825 [Homo sapiens]
                          GCCCCGGCCAGGGGAGCTGCAAGCA[C/G]CCACGTACGCGACAGGGTCAGAGGA
                          Chromosome:
                          7:99047942
                          Gene:
                          SMURF1 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          C=0.4800/2404
                          HGVS:
                          NC_000007.13:g.98645565C>G, NC_000007.14:g.99047942C>G, NM_001199847.1:c.954-60G>C, NM_020429.2:c.1032-60G>C, NM_181349.2:c.954-60G>C, XM_005250507.1:c.1032-60G>C, XM_017012457.1:c.1032-60G>C, XR_242315.1:n.826C>G
                          15.

                          rs157702 [Homo sapiens]
                            CATACATATTTAAGAACTGTGAATG[C/T]AGTAGTAAGGAAATTAGGCTGTGTT
                            Chromosome:
                            6:90517962
                            Gene:
                            MAP3K7 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                            Global MAF:
                            C=0.3265/1635
                            HGVS:
                            NC_000006.11:g.91227681C>T, NC_000006.12:g.90517962C>T, NG_011966.2:g.74227G>A, NM_003188.3:c.1559+485G>A, NM_145331.2:c.1640+485G>A, NM_145332.2:c.1525-1281G>A, NM_145333.2:c.1444-1281G>A, XM_006715553.2:c.1250+485G>A, XM_017011226.1:c.1169+485G>A
                            16.

                            rs5985 [Homo sapiens]
                              CCTGCCCACAGTGGAGCTTCAGGGC[A/G/T]TGGTGCCCCGGGGCGTCAACCTGCA
                              Chromosome:
                              6:6318562
                              Gene:
                              F13A1 (GeneView)
                              Functional Consequence:
                              missense
                              Allele Origin:
                              G(germline)/T(germline)
                              Clinical significance:
                              other
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.1478/740
                              HGVS:
                              NC_000006.11:g.6318795C>A, NC_000006.12:g.6318562C>A, NG_008107.1:g.7130G>T, NM_000129.3:c.103G>T, NP_000120.2:p.Val35Leu

                              Display Settings:

                              Format
                              Items per page
                              Sort by

                              Send to:

                              Choose Destination

                              Supplemental Content

                              Find related data

                              Recent activity

                              Your browsing activity is empty.

                              Activity recording is turned off.

                              Turn recording back on

                              See more...
                              Support Center