Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

2.

rs113993961 [Homo sapiens]
    TAAAAGATCCTTTTTGCTTTTAATA[C/G]GGTAGAAATTGGCTTCATAAAGCTA
    Chromosome:
    8:31141680
    Gene:
    WRN (GeneView)
    Functional Consequence:
    splice acceptor variant
    Allele Origin:
    G(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by 1000G,by cluster
    Global MAF:
    C=0.0002/1
    HGVS:
    NC_000008.10:g.30999196G>C, NC_000008.11:g.31141680G>C, NG_008870.1:g.113419G>C, NM_000553.4:c.3139-1G>C, XM_005273632.1:c.3058-1G>C, XM_011544639.1:c.3058-1G>C, XM_011544640.1:c.1540-1G>C, XR_949470.1:n.3412-1G>C, XR_949471.1:n.3412-1G>C, XR_949472.1:n.3412-1G>C
    3.

    rs17847577 [Homo sapiens]
      AGATGTACTTGGAAATAAAGTGGAA[C/T]GAAAAGAAGATGGATTTGAAGATGG
      Chromosome:
      8:31081132
      Gene:
      WRN (GeneView)
      Functional Consequence:
      nc transcript variant,stop gained
      Allele Origin:
      T(germline)/C(germline)
      Clinical significance:
      Pathogenic
      Validated:
      by cluster,by frequency
      HGVS:
      NC_000008.10:g.30938648C>T, NC_000008.11:g.31081132C>T, NG_008870.1:g.52871C>T, NM_000553.4:c.1105C>T, NP_000544.2:p.Arg369Ter, XM_005273632.1:c.1105C>T, XM_011544639.1:c.1105C>T, XP_005273689.1:p.Arg369Ter, XP_011542941.1:p.Arg369Ter, XR_949470.1:n.1378C>T, XR_949471.1:n.1378C>T, XR_949472.1:n.1378C>T

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center