Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 211

2.

rs36212733 [Homo sapiens]
    TTTGTGCTTGCCATAGTATATATAA[C/T]TAGACAAATGAGAGAACACAAAGGT
    Chromosome:
    10:122455695
    Gene:
    ARMS2 (GeneView) LOC105378525 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    C=0.2865/1435
    HGVS:
    CM000672.2:g.122455695T>C, NC_000010.10:g.124215211T>C, NC_000010.11:g.122455695T>C, NG_011725.1:g.6033T>C, NM_001099667.1:c.297+671T>C, NM_001099667.2:c.297+671T>C, XR_946382.2:n.1855+2800A>G, XR_946383.2:n.1855+2800A>G, XR_946384.2:n.1580+2800A>G, XR_946385.2:n.1856-674A>G
    3.

    rs36212732 [Homo sapiens]
      GGAACTGTGGCGCTTTGTGCTTGCC[A/G]TAGTATATATAATTAGACAAATGAG
      Chromosome:
      10:122455682
      Gene:
      ARMS2 (GeneView) LOC105378525 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      G=0.2865/1435
      HGVS:
      CM000672.2:g.122455682A>G, NC_000010.10:g.124215198A>G, NC_000010.11:g.122455682A>G, NG_011725.1:g.6020A>G, NM_001099667.1:c.297+658A>G, NM_001099667.2:c.297+658A>G, XR_946382.2:n.1855+2813T>C, XR_946383.2:n.1855+2813T>C, XR_946384.2:n.1580+2813T>C, XR_946385.2:n.1856-661T>C
      6.

      rs36212729 [Homo sapiens]
        ATTCTTTCTAAAAATATGGAACTGA[A/T]AGAAAAGAAACTTATAGACTACATT
        Chromosome:
        10:122897855
        Gene:
        LOC399815 (GeneView)
        Functional Consequence:
        nc transcript variant
        Validated:
        no info
        HGVS:
        CM000672.2:g.122897855T>A, NC_000010.10:g.124657371T>A, NC_000010.11:g.122897855T>A, NR_027282.1:n.1253T>A
        7.

        rs36212728 [Homo sapiens]
          CGAAAAACCGCCGTGGTGCCCGCGC[A/G]CAGTGCACCGCGCCTGCGCATGGTC
          Chromosome:
          10:122879577
          Gene:
          FAM24B-CUZD1 (GeneView) FAM24B (GeneView) LOC399815 (GeneView)
          Functional Consequence:
          nc transcript variant,upstream variant 2KB,utr variant 5 prime
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          G=0.0302/151
          HGVS:
          CM000672.2:g.122879577A>G, NC_000010.10:g.124639093A>G, NC_000010.11:g.122879577A>G, NM_001204364.1:c.-240T>C, NM_152644.2:c.-270T>C, NR_027282.1:n.-56A>G, NR_037911.1:n.65T>C, NR_037915.1:n.65T>C
          8.

          rs36212727 [Homo sapiens]
            TACCTGACCATAGACGCTCCCCATC[A/C/T]GCCCAGCAACCGTGGTCCATGCTGC
            Chromosome:
            10:122879507
            Gene:
            FAM24B-CUZD1 (GeneView) FAM24B (GeneView) LOC399815 (GeneView)
            Functional Consequence:
            nc transcript variant,upstream variant 2KB,utr variant 5 prime
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            T=0.0088/44
            HGVS:
            CM000672.2:g.122879507C>A, CM000672.2:g.122879507C>T, NC_000010.10:g.124639023C>T, NC_000010.11:g.122879507C>A, NC_000010.11:g.122879507C>T, NM_001204364.1:c.-170G>A, NM_001204364.1:c.-170G>T, NM_152644.2:c.-200G>A, NM_152644.2:c.-200G>T, NR_027282.1:n.-126C>A, NR_027282.1:n.-126C>T, NR_037911.1:n.135G>A, NR_037911.1:n.135G>T, NR_037915.1:n.135G>A, NR_037915.1:n.135G>T
            9.

            rs36212726 [Homo sapiens]
              AGGCAGGGAGAGTTCGGAGTAAAAT[C/T]AACCCGAATGGACAGCGCTTCCGCC
              Chromosome:
              10:122879331
              Gene:
              FAM24B-CUZD1 (GeneView) FAM24B (GeneView) LOC399815 (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              C=0.0156/78
              HGVS:
              CM000672.2:g.122879331T>C, NC_000010.10:g.124638847T>C, NC_000010.11:g.122879331T>C, NM_001204364.1:c.-148+154A>G, NM_152644.2:c.-178+154A>G, NR_027282.1:n.-302T>C, NR_037911.1:n.157+154A>G, NR_037915.1:n.157+154A>G
              10.
              11.

              rs36212724 [Homo sapiens]
                GGTATTTAGCTAAATGACTGTGTAA[A/G]AATCACCTGTGGAAGGTATATTCCC
                Chromosome:
                10:122862874
                Gene:
                FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency
                Global MAF:
                A=0.0192/96
                HGVS:
                CM000672.2:g.122862874G>A, NC_000010.10:g.124622390G>A, NC_000010.11:g.122862874G>A, NM_001204364.1:c.-147-7088C>T, NM_152644.2:c.-177-7088C>T, NR_037911.1:n.158-7088C>T, NR_037915.1:n.158-7088C>T
                12.

                rs36212413 [Homo sapiens]
                  TTCTCTCCAGGTGTCCAAATGGGAG[A/G]AACCAATTGCTGATGGTATTTAGCT
                  Chromosome:
                  10:122862834
                  Gene:
                  FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  G=0.0164/82
                  HGVS:
                  CM000672.2:g.122862834A>G, NC_000010.10:g.124622350A>G, NC_000010.11:g.122862834A>G, NM_001204364.1:c.-147-7048T>C, NM_152644.2:c.-177-7048T>C, NR_037911.1:n.158-7048T>C, NR_037915.1:n.158-7048T>C
                  13.

                  rs36212412 [Homo sapiens]
                    ACAAATGCAAATAATAATTCTTCTA[A/G]TATAACAATGTTCCTTCTGCCTTAT
                    Chromosome:
                    10:122862734
                    Gene:
                    FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency
                    Global MAF:
                    G=0.0192/96
                    HGVS:
                    CM000672.2:g.122862734A>G, NC_000010.10:g.124622250A>G, NC_000010.11:g.122862734A>G, NM_001204364.1:c.-147-6948T>C, NM_152644.2:c.-177-6948T>C, NR_037911.1:n.158-6948T>C, NR_037915.1:n.158-6948T>C
                    14.

                    rs36212411 [Homo sapiens]
                      TTGCAGACTTCAGGTTTCCATCAGC[A/G]GTTCCTCTTCCAGGACTCAGGAAAC
                      Chromosome:
                      10:122858991
                      Gene:
                      FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency
                      Global MAF:
                      A=0.0200/100
                      HGVS:
                      CM000672.2:g.122858991G>A, NC_000010.10:g.124618507G>A, NC_000010.11:g.122858991G>A, NM_001204364.1:c.-147-3205C>T, NM_152644.2:c.-177-3205C>T, NR_037911.1:n.158-3205C>T, NR_037915.1:n.158-3205C>T
                      15.

                      rs36212410 [Homo sapiens]
                        TTTGTTTTGTTGGGTGGGGGCACAC[A/T]TTCATGAGTCATATCTCCAGGAACT
                        Chromosome:
                        10:122852435
                        Gene:
                        FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency
                        Global MAF:
                        T=0.0200/100
                        HGVS:
                        CM000672.2:g.122852435A>T, NC_000010.10:g.124611951A>T, NC_000010.11:g.122852435A>T, NM_001204364.1:c.-5-1915T>A, NM_152644.2:c.-35-1885T>A, NR_037911.1:n.300-2996T>A, NR_037915.1:n.299+3210T>A
                        16.

                        rs36212409 [Homo sapiens]
                          GAGTGAGTGATTTTGCAAGCAAGGT[C/T]ACCCAACTGGTCACTGCAGGCCCCC
                          Chromosome:
                          10:122849679
                          Gene:
                          FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          no info
                          HGVS:
                          CM000672.2:g.122849679C>T, NC_000010.10:g.124609195C>T, NC_000010.11:g.122849679C>T, NM_001204364.1:c.93-240G>A, NM_152644.2:c.93-240G>A, NR_037911.1:n.300-240G>A, NR_037915.1:n.300-3459G>A
                          17.

                          rs36212408 [Homo sapiens]
                            TAAATGTAAACTGAGGTTACAAAAG[C/T]AAGAGTGAGTGATTTTGCAAGCAAG
                            Chromosome:
                            10:122849651
                            Gene:
                            FAM24B-CUZD1 (GeneView) FAM24B (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            no info
                            HGVS:
                            CM000672.2:g.122849651C>T, NC_000010.10:g.124609167C>T, NC_000010.11:g.122849651C>T, NM_001204364.1:c.93-212G>A, NM_152644.2:c.93-212G>A, NR_037911.1:n.300-212G>A, NR_037915.1:n.300-3431G>A
                            18.

                            rs36212407 [Homo sapiens]
                              TGGGGAGCTGTGCCTTTCTTCTGTG[C/T]CTGCACATCACAAACAGGTGGCCTC
                              Chromosome:
                              10:122846150
                              Gene:
                              CUZD1 (GeneView) FAM24B-CUZD1 (GeneView)
                              Functional Consequence:
                              nc transcript variant,utr variant 5 prime
                              Validated:
                              by 1000G,by cluster,by frequency
                              Global MAF:
                              T=0.0499/250
                              HGVS:
                              CM000672.2:g.122846150C>T, NC_000010.10:g.124605666C>T, NC_000010.11:g.122846150C>T, NM_022034.5:c.-307G>A, NR_037912.1:n.26G>A, NR_037915.1:n.370G>A
                              19.

                              rs36212406 [Homo sapiens]
                                TGCTGACCTTGAAGGACCTCTGTGA[A/G/T]CCAGTGCCGGGCACACAGCCATCAT
                                Chromosome:
                                10:122840986
                                Gene:
                                CUZD1 (GeneView) FAM24B-CUZD1 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency
                                Global MAF:
                                A=0.0006/3
                                HGVS:
                                CM000672.2:g.122840986G>A, CM000672.2:g.122840986G>T, NC_000010.10:g.124600502G>A, NC_000010.11:g.122840986G>A, NC_000010.11:g.122840986G>T, NM_022034.5:c.233+192C>A, NM_022034.5:c.233+192C>T, NR_037912.1:n.415-1755C>A, NR_037912.1:n.415-1755C>T, NR_037915.1:n.909+192C>A, NR_037915.1:n.909+192C>T
                                20.

                                rs36212405 [Homo sapiens]
                                  TGTGCATTGAGCTTAACACATCTCT[C/T]CTGAGTATGATTCCATCTCTATCTT
                                  Chromosome:
                                  10:122837645
                                  Gene:
                                  CUZD1 (GeneView) FAM24B-CUZD1 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  no info
                                  HGVS:
                                  CM000672.2:g.122837645C>T, NC_000010.10:g.124597161C>T, NC_000010.11:g.122837645C>T, NM_022034.5:c.449-91G>A, NR_037912.1:n.630-91G>A, NR_037915.1:n.1125-91G>A

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center