Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs2251644 [Homo sapiens]
    TAGTGAATGCCCACATATTGATAAC[A/G]TGCATCTTTCTGGTTTGAATTCAGA
    Chromosome:
    14:102001510
    Gene:
    DYNC1H1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.2736/1370
    HGVS:
    NC_000014.8:g.102467847A>G, NC_000014.9:g.102001510A>G, NG_008777.1:g.41983A>G, NM_001376.4:c.4396-25A>G
    2.

    rs941793 [Homo sapiens]
      TTAACTCCTTAGCATTAGGCAGGAG[C/T]TCCCCATCTAGTTCTCTTGTGGTCT
      Chromosome:
      14:102041124
      Gene:
      DYNC1H1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.3870/1938
      HGVS:
      NC_000014.8:g.102507461A>G, NC_000014.9:g.102041124A>G, NG_008777.1:g.81597A>G, NM_001376.4:c.11942-450A>G

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center