Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 13

1.

rs3918347 [Homo sapiens]
    CAGATGGCTCTGGCATTTTCAGGGA[A/G]CAGTCATGTCTGATCTCAAGTTCCA
    Chromosome:
    12:108899544
    Gene:
    DAO (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.4125/2066
    HGVS:
    NC_000012.11:g.109293320A>G, NC_000012.12:g.108899544A>G, NG_023236.1:g.24464A>G, NM_001917.4:c.912+69A>G, XM_005268692.1:c.846+69A>G, XM_005268692.3:c.846+69A>G, XM_011538004.2:c.912+69A>G, XM_011538005.2:c.912+69A>G
    2.

    rs3788319 [Homo sapiens]
      GTGAAGTGATCTGACGTTGGGTGGG[A/G]GTCTCCGGACTTGGGGTGGGGAATC
      Chromosome:
      22:19942028
      Gene:
      COMT (GeneView) TXNRD2 (GeneView)
      Functional Consequence:
      intron variant,upstream variant 2KB
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      A=0.4972/2490
      HGVS:
      NC_000022.10:g.19929551A>G, NC_000022.11:g.19942028A>G, NG_011526.1:g.5289A>G, NG_011835.1:g.4809T>C, NM_000754.3:c.-92+131A>G, NM_001282512.1:c.-225T>C, NM_006440.4:c.-225T>C, XM_005261214.1:c.-225T>C, XM_005261216.1:c.-225T>C, XM_005261217.1:c.-225T>C, XM_005261229.1:c.-386+131A>G, XM_017028594.1:c.-386+131A>G, XM_017028595.1:c.-533A>G
      3.
      4.

      rs3782221 [Homo sapiens]
        CCGCACAGACCCACAGAACCTGAGT[A/G]ACAGGCAACACATGAAGTCTTGTCA
        Chromosome:
        12:117358076
        Gene:
        NOS1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.3205/1605
        HGVS:
        NC_000012.11:g.117795881G>A, NC_000012.12:g.117358076G>A, NG_011991.2:g.8702C>T, NM_000620.4:c.-421+3436C>T, NM_001204218.1:c.-421+3436C>T, XM_005253885.1:c.-421+3436C>T, XM_011538398.2:c.-421+915C>T, XM_017019345.1:c.-420-26587C>T, XM_017019346.1:c.-420-26587C>T, XM_017019347.1:c.-421+3051C>T
        5.

        rs3782219 [Homo sapiens]
          CTGGGTGCTTTATTTAGGACTCCAC[C/T]CTACAATTTGCAGGCTAAGTTGCAA
          Chromosome:
          12:117350435
          Gene:
          NOS1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.1803/903
          HGVS:
          NC_000012.11:g.117788240C>T, NC_000012.12:g.117350435C>T, NG_011991.2:g.16343G>A, NM_000620.4:c.-421+11077G>A, NM_001204218.1:c.-421+11077G>A, XM_005253885.1:c.-421+11077G>A, XM_011538398.2:c.-421+8556G>A, XM_017019345.1:c.-420-18946G>A, XM_017019346.1:c.-420-18946G>A, XM_017019347.1:c.-421+10692G>A
          6.

          rs3741775 [Homo sapiens]
            CACTTGGCTGTGTGACCTTAGGAAG[G/T]CACTTAGCCTCTCTGAAACTCAGTA
            Chromosome:
            12:108889827
            Gene:
            DAO (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.3129/1567
            HGVS:
            NC_000012.11:g.109283603A>C, NC_000012.12:g.108889827A>C, NG_023236.1:g.14747A>C, NM_001917.4:c.386+282A>C, XM_005268692.1:c.386+282A>C, XM_005268692.3:c.386+282A>C, XM_011538004.2:c.386+282A>C, XM_011538005.2:c.386+282A>C
            7.

            rs2344671 [Homo sapiens]
              TTGATTAATAACTCTAGGATCTCAG[A/G]TGGATCCAGCACATAGAAATATGAA
              Chromosome:
              1:163071074
              Gene:
              RGS4 (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              A=0.0929/465
              HGVS:
              NC_000001.10:g.163040864G>A, NC_000001.11:g.163071074G>A, NG_023312.1:g.7469G>A, NM_001102445.2:c.336-1321G>A, NM_001113380.1:c.-1080G>A, NM_001113381.1:c.45-1321G>A, NM_005613.5:c.45-1321G>A
              8.

              rs2016118 [Homo sapiens]
                TCGCTCTTCCCTCCTCTGTTGTCCC[A/G]GGTCGTGCCCATGTGTGCGATCATG
                Chromosome:
                22:18928303
                Gene:
                PRODH (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                T=0.1989/996
                HGVS:
                NC_000022.10:g.18915816T>C, NC_000022.11:g.18928303T>C, NG_008226.2:g.13251A>G, NM_001195226.1:c.159-2581A>G, NM_016335.4:c.483-2581A>G, XM_005261255.1:c.-26-2581A>G, XM_005261256.1:c.159-2581A>G
                9.

                rs951439 [Homo sapiens]
                  TGCTGTGTGGCTGAATGTCTGCCCC[C/G/T]CAGTAGGAAACAGTTCTTCTAAAGC
                  Chromosome:
                  1:163063901
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  T=0.4573/2290
                  HGVS:
                  NC_000001.10:g.163033691C>T, NC_000001.11:g.163063901C>G, NC_000001.11:g.163063901C>T, NG_023312.1:g.296C>G, NG_023312.1:g.296C>T
                  10.

                  Display Settings:

                  Format
                  Items per page
                  Sort by

                  Send to:

                  Choose Destination

                  Supplemental Content

                  Find related data

                  Recent activity

                  Your browsing activity is empty.

                  Activity recording is turned off.

                  Turn recording back on

                  See more...
                  Support Center