Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 38

1.

rs12560201 [Homo sapiens]
    tccactttccacataccataattct[A/G]aaacaaagcagaggtgggtttagct
    Chromosome:
    X:64332496
    Gene:
    MTMR8 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.0207/78
    HGVS:
    NC_000023.10:g.63552376A>G, NC_000023.11:g.64332496A>G, NG_016567.1:g.67958T>C, NM_017677.3:c.1152-739T>C
    2.

    rs10521339 [Homo sapiens]
      TTATGGATTGAAAAGATTCTCATAT[A/T]ATACTAACAGCCCCTTCTAGTTCTA
      Chromosome:
      X:67288544
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.3319/1253
      HGVS:
      NC_000023.10:g.66508386A>T, NC_000023.11:g.67288544A>T
      3.

      rs7887862 [Homo sapiens]
        GGTTGATGAAAACCAGCTTACATCT[C/T]GGTTATCATTCATATCACCTATCAC
        Chromosome:
        X:68145273
        Gene:
        OPHN1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.3189/1204
        HGVS:
        NC_000023.10:g.67365115T>C, NC_000023.11:g.68145273T>C, NG_008960.1:g.293185A>G, NM_002547.2:c.1277-25941A>G, XM_005262270.1:c.1277-25941A>G, XM_006724653.2:c.1277-25941A>G, XM_011530961.1:c.1277-25941A>G, XM_017029555.1:c.1277-25941A>G
        4.

        rs5965536 [Homo sapiens]
          AAGGATAATATAAAAGTATGTCCAA[C/G]ATACTATTTCTGTGCAGGAATATCT
          Chromosome:
          X:68297933
          Gene:
          OPHN1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.3841/1450
          HGVS:
          NC_000023.10:g.67517775G>C, NC_000023.11:g.68297933G>C, NG_008960.1:g.140525C>G, NM_002547.2:c.250+1068C>G, XM_005262270.1:c.250+1068C>G, XM_006724653.2:c.250+1068C>G, XM_011530961.1:c.250+1068C>G, XM_017029555.1:c.250+1068C>G
          5.

          rs5964577 [Homo sapiens]
            TAGTTTTCTAACTTCATTTCTAATA[A/T]GTATCAACTGGTGTAGGTACACTTA
            Chromosome:
            X:66951649
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.3240/1223
            HGVS:
            NC_000023.10:g.66171491T>A, NC_000023.11:g.66951649T>A
            6.

            rs5919393 [Homo sapiens]
              CTCACCCTTTTTGCTTAGATAGTTC[C/T]ACTTTCATTGTGGACAGACTCTTTG
              Chromosome:
              X:67605515
              Gene:
              AR (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              C=0.3224/1217
              HGVS:
              NC_000023.10:g.66825357C>T, NC_000023.11:g.67605515C>T, NG_009014.2:g.66484C>T, NM_000044.3:c.1617-37741C>T, NM_001011645.2:c.20+36493C>T, XM_005262263.1:c.1617-37741C>T, XM_005262264.1:c.1617-37741C>T, XR_244495.1:n.2301-37741C>T, XR_244496.1:n.2301-37741C>T, XR_244497.1:n.2300+58753C>T
              7.

              rs5919287 [Homo sapiens]
                GAAGACAATGGTAGAGATGTTACCC[C/T]TGGTTTGTAGGAGTATTTGGCATTG
                Chromosome:
                X:67140772
                Validated:
                by 1000G,by cluster,by frequency,by hapmap
                HGVS:
                NC_000023.10:g.66360614T>C, NC_000023.11:g.67140772T>C
                8.

                rs2885913 [Homo sapiens]
                  agggaacagatataggagctggtca[C/T]tccacattttgagccctctcagagg
                  Chromosome:
                  X:67895961
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  G=0.4901/1850
                  HGVS:
                  NC_000023.10:g.67115803A>G, NC_000023.11:g.67895961A>G
                  9.

                  rs2781516 [Homo sapiens]
                    GGAAGTAAAACACAGAGAAATAAAT[A/G]ACATTAATATTTTGACAATGAAAAG
                    Chromosome:
                    X:67882189
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    A=0.2840/1072
                    HGVS:
                    NC_000023.10:g.67102031G>A, NC_000023.11:g.67882189G>A
                    10.

                    rs2497935 [Homo sapiens]
                      TAAACTGGTGGGTGGGCCTGCCAGA[A/G]GCTTATATGACAGAGGATCAAGGAG
                      Chromosome:
                      X:67444424
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      G=0.3311/1250
                      HGVS:
                      NC_000023.10:g.66664266A>G, NC_000023.11:g.67444424A>G
                      11.

                      rs2363785 [Homo sapiens]
                        CTCAGTGAATATAAATCAATTATTC[A/C]GAGCAATTCACCCCCAGGGAAGCTG
                        Chromosome:
                        X:67951456
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.4591/1733
                        HGVS:
                        NC_000023.10:g.67171298G>T, NC_000023.11:g.67951456G>T
                        12.

                        rs2223841 [Homo sapiens]
                          TATATTTTGAATTATCCAGAGTGCT[A/G]GTGGAGTTTCTTGACAGGGGTCTCA
                          Chromosome:
                          X:67350329
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          C=0.3298/1245
                          HGVS:
                          NC_000023.10:g.66570171T>C, NC_000023.11:g.67350329T>C
                          13.

                          rs2221799 [Homo sapiens]
                            ACTTTCATATTCAAGATGAAGTATA[A/G]GTTAGTAGGAAAAGTGCTGTAATAT
                            Chromosome:
                            X:67156774
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            G=0.3242/1224
                            HGVS:
                            NC_000023.10:g.66376616G>A, NC_000023.11:g.67156774G>A
                            14.

                            rs2207081 [Homo sapiens]
                              CAGTAGAAAAATTGTGTCTTTTAAA[A/G]CAGAGCTTCATTGCAAATTTTAAGA
                              Chromosome:
                              X:67353856
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              C=0.3311/1250
                              HGVS:
                              NC_000023.10:g.66573698T>C, NC_000023.11:g.67353856T>C
                              15.

                              rs1936313 [Homo sapiens]
                                GGAGACACAGATCATACAAGCACCA[C/T]TTTTACAGACATATTGCAGTTCTCA
                                Chromosome:
                                X:67980806
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                C=0.4199/1585
                                HGVS:
                                NC_000023.10:g.67200648T>C, NC_000023.11:g.67980806T>C
                                16.

                                rs1927232 [Homo sapiens]
                                  GTTAACAAAAATAGTTGGAGTTCGC[A/G]AAAGCCTATTATTTAGGCAAAGTCT
                                  Chromosome:
                                  X:68163049
                                  Gene:
                                  OPHN1 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  T=0.3128/1181
                                  HGVS:
                                  NC_000023.10:g.67382891C>T, NC_000023.11:g.68163049C>T, NG_008960.1:g.275409G>A, NM_002547.2:c.1276+29870G>A, XM_005262270.1:c.1276+29870G>A, XM_006724653.2:c.1276+29870G>A, XM_011530961.1:c.1276+29870G>A, XM_017029555.1:c.1276+29870G>A
                                  18.

                                  rs1410127 [Homo sapiens]
                                    GATAAAATTCCATCAGCAAACACTA[C/T]TGATTCTTATTTTAAAGTTGACTGT
                                    Chromosome:
                                    X:68060539
                                    Gene:
                                    OPHN1 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    T=0.4207/1588
                                    HGVS:
                                    NC_000023.10:g.67280381C>T, NC_000023.11:g.68060539C>T, NG_008960.1:g.377919G>A, NM_002547.2:c.2158+3315G>A, XM_005262270.1:c.1835-6729G>A, XM_006724653.2:c.2158+3315G>A, XM_011530961.1:c.2158+3315G>A
                                    19.

                                    rs1385699 [Homo sapiens]
                                      AGCACAGGTGATGCAACTCTGACAT[C/T]TGTGGTGGCCCCAGCTGCTTTTGTA
                                      Chromosome:
                                      X:66605144
                                      Gene:
                                      EDA2R (GeneView)
                                      Functional Consequence:
                                      intron variant,missense,nc transcript variant
                                      Validated:
                                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                      Global MAF:
                                      C=0.3346/1263
                                      HGVS:
                                      NC_000023.10:g.65824986C>T, NC_000023.11:g.66605144C>T, NG_013271.2:g.39123G>A, NM_001199687.2:c.170G>A, NM_001242310.1:c.170G>A, NM_001324199.1:c.72-2347G>A, NM_001324201.1:c.154G>A, NM_001324202.1:c.72-2347G>A, NM_001324204.1:c.56-2347G>A, NM_001324205.1:c.56-2347G>A, NM_001324206.1:c.170G>A, NM_021783.4:c.170G>A, NP_001186616.1:p.Arg57Lys, NP_001229239.1:p.Arg57Lys, NP_001311130.1:p.Asp52Asn, NP_001311135.1:p.Arg57Lys, NP_068555.1:p.Arg57Lys, NR_136726.1:n.278G>A, NR_136727.1:n.280G>A, XM_005262283.1:c.170G>A, XM_005262284.1:c.170G>A, XM_005262285.1:c.72-2347G>A, XM_011531000.1:c.170G>A, XM_011531001.1:c.170G>A, XM_011531002.1:c.170G>A, XM_011531003.2:c.170G>A, XM_011531004.1:c.170G>A, XM_011531005.2:c.72-2347G>A, XM_011531006.2:c.170G>A, XM_011531007.2:c.170G>A, XM_017029703.1:c.154G>A, XM_017029704.1:c.170G>A, XM_017029705.1:c.56-2347G>A, XM_017029706.1:c.170G>A, XM_017029707.1:c.72-2347G>A, XM_017029708.1:c.72-2347G>A, XP_005262340.1:p.Arg57Lys, XP_005262341.1:p.Arg57Lys, XP_011529302.1:p.Arg57Lys, XP_011529303.1:p.Arg57Lys, XP_011529304.1:p.Arg57Lys, XP_011529305.1:p.Arg57Lys, XP_011529306.1:p.Arg57Lys, XP_011529308.1:p.Arg57Lys, XP_011529309.1:p.Arg57Lys, XP_016885192.1:p.Asp52Asn, XP_016885193.1:p.Arg57Lys, XP_016885195.1:p.Arg57Lys, XR_244498.1:n.272G>A, XR_244499.1:n.280G>A, XR_938405.2:n.270G>A
                                      20.

                                      rs1385695 [Homo sapiens]
                                        TATTTATTTTTCTGCACTCCATTTA[A/G]GCTATTTGTTTATGCGTGGGTTTGA
                                        Chromosome:
                                        X:66684670
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                        Global MAF:
                                        G=0.3248/1226
                                        HGVS:
                                        NC_000023.10:g.65904512G>A, NC_000023.11:g.66684670G>A

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center