Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs6661174 [Homo sapiens]
    CTATTTCGGACCCTGCAACTCCTAT[C/T]AGTATCGCCTGGTTGGGCCTGGGCA
    Chromosome:
    1:171208951
    Gene:
    FMO2 (GeneView) LOC105371611 (GeneView)
    Functional Consequence:
    intron variant,nc transcript variant,stop gained
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0463/232
    HGVS:
    NC_000001.10:g.171178090T>C, NC_000001.11:g.171208951C>T, NM_001301347.1:c.754C, NM_001301347.1:c.754C>T, NM_001460.4:c.1414C, NM_001460.4:c.1414C>T, NP_001288276.1:p.Gln252, NP_001288276.1:p.Gln252Ter, NP_001451.2:p.Gln472, NP_001451.2:p.Gln472Ter, XM_005245039.1:c.*90T>C, XR_001737072.1:n.1531C>T, XR_001738291.1:n.1306+38630G>A, XR_426768.3:n.1531C>T, XR_921761.2:n.1531C>T, XR_922278.2:n.1306+38630G>A
    2.

    rs2234889 [Homo sapiens]
      CTTGCTGTTGTTGTGGCCTTTTTTT[-/T]GCCAACTTCAATGGTCCTAGTCAGC
      Chromosome:
      1:171209118
      Gene:
      FMO2 (GeneView) LOC105371611 (GeneView)
      Functional Consequence:
      frameshift variant,intron variant,nc transcript variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      T=0.1747/875
      HGVS:
      NC_000001.10:g.171178257_171178258insT, NC_000001.11:g.171209118_171209119insT, NM_001301347.1:c.921_922insT, NM_001460.4:c.1581_1582insT, NP_001288276.1:p.Cys310Leufs, NP_001451.2:p.Cys530Leufs, XM_005245039.1:c.*257_*258insT, XR_001737072.1:n.1698_1699insT, XR_001738291.1:n.1306+38462_1306+38463insA, XR_426768.3:n.1698_1699insT, XR_921761.2:n.1698_1699insT, XR_922278.2:n.1306+38462_1306+38463insA

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center