Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs79891110 [Homo sapiens]
    TAACTTGGTTCTCGGTGTGCTTAGC[A/G]GGTAAGCAGGACCAAGGAAAAAGGT
    Chromosome:
    12:2504944
    Gene:
    CACNA1C (GeneView)
    Functional Consequence:
    intron variant,missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000012.11:g.2614110G>A, NC_000012.12:g.2504944G>A, NG_008801.2:g.539159G>A, NM_000719.6:c.1216G>A, NM_001129827.1:c.1216G>A, NM_001129829.1:c.1216G>A, NM_001129830.1:c.1216G>A, NM_001129830.2:c.1216G>A, NM_001129831.1:c.1216G>A, NM_001129832.1:c.1216G>A, NM_001129833.1:c.1216G>A, NM_001129834.1:c.1216G>A, NM_001129835.1:c.1216G>A, NM_001129836.1:c.1216G>A, NM_001129837.1:c.1216G>A, NM_001129838.1:c.1216G>A, NM_001129839.1:c.1216G>A, NM_001129840.1:c.1217+405G>A, NM_001129841.1:c.1216G>A, NM_001129842.1:c.1216G>A, NM_001129843.1:c.1216G>A, NM_001129844.1:c.1207G>A, NM_001129846.1:c.1216G>A, NM_001167623.1:c.1217+405G>A, NM_001167624.2:c.1217+405G>A, NM_001167625.1:c.1217+405G>A, NM_199460.3:c.1216G>A, NP_000710.5:p.Gly406Arg, NP_001123299.1:p.Gly406Arg, NP_001123301.1:p.Gly406Arg, NP_001123302.1:p.Gly406Arg, NP_001123302.2:p.Gly406Arg, NP_001123303.1:p.Gly406Arg, NP_001123304.1:p.Gly406Arg, NP_001123305.1:p.Gly406Arg, NP_001123306.1:p.Gly406Arg, NP_001123307.1:p.Gly406Arg, NP_001123308.1:p.Gly406Arg, NP_001123309.1:p.Gly406Arg, NP_001123310.1:p.Gly406Arg, NP_001123311.1:p.Gly406Arg, NP_001123313.1:p.Gly406Arg, NP_001123314.1:p.Gly406Arg, NP_001123315.1:p.Gly406Arg, NP_001123316.1:p.Gly403Arg, NP_001123318.1:p.Gly406Arg, NP_955630.3:p.Gly406Arg, XM_005253765.1:c.1307+405G>A, XM_005253766.1:c.1225G>A, XM_005253767.1:c.1226+405G>A, XM_005253768.1:c.1225G>A, XM_005253769.1:c.1225G>A, XM_005253770.1:c.1225G>A, XM_005253771.1:c.1226+405G>A, XM_005253772.1:c.1225G>A, XM_005253773.1:c.1225G>A, XM_005253774.1:c.1225G>A, XM_005253775.1:c.1225G>A, XM_005253776.1:c.1225G>A, XM_005253777.1:c.1225G>A, XM_005253778.1:c.1225G>A, XM_005253779.1:c.1225G>A, XM_005253780.1:c.1225G>A, XM_005253781.1:c.1226+405G>A, XM_005253782.1:c.1225G>A, XM_005253783.1:c.1226+405G>A, XM_005253784.1:c.1225G>A, XM_005253785.1:c.1225G>A, XM_005253786.1:c.1216G>A, XM_005253787.1:c.1225G>A, XM_006719017.2:c.1307+405G>A, XM_011521020.2:c.1307+405G>A, XM_011521023.2:c.1216G>A, XM_017019926.1:c.1385+405G>A, XM_017019927.1:c.1384G>A, XM_017019928.1:c.1384G>A, XM_017019929.1:c.1384G>A, XM_017019930.1:c.1384G>A, XM_017019931.1:c.1384G>A, XM_017019932.1:c.1385+405G>A, XM_017019933.1:c.1384G>A, XM_017019934.1:c.1385+405G>A, XM_017019935.1:c.1384G>A, XM_017019936.1:c.1384G>A, XM_017019937.1:c.1384G>A, XM_017019938.1:c.1384G>A, XM_017019939.1:c.1384G>A, XM_017019940.1:c.1384G>A, XM_017019941.1:c.1384G>A, XM_017019942.1:c.1384G>A, XM_017019943.1:c.1385+405G>A, XM_017019944.1:c.1384G>A, XM_017019945.1:c.1384G>A, XM_017019946.1:c.1385+405G>A, XM_017019947.1:c.1385+405G>A, XM_017019948.1:c.1384G>A, XM_017019949.1:c.1385+405G>A, XM_017019950.1:c.1385+405G>A, XM_017019951.1:c.1375G>A, XM_017019952.1:c.1384G>A, XM_017019953.1:c.1307+405G>A, XM_017019954.1:c.1307+405G>A, XM_017019955.1:c.1384G>A, XP_005253823.1:p.Gly409Arg, XP_005253825.1:p.Gly409Arg, XP_005253826.1:p.Gly409Arg, XP_005253827.1:p.Gly409Arg, XP_005253829.1:p.Gly409Arg, XP_005253830.1:p.Gly409Arg, XP_005253831.1:p.Gly409Arg, XP_005253832.1:p.Gly409Arg, XP_005253833.1:p.Gly409Arg, XP_005253834.1:p.Gly409Arg, XP_005253835.1:p.Gly409Arg, XP_005253836.1:p.Gly409Arg, XP_005253837.1:p.Gly409Arg, XP_005253839.1:p.Gly409Arg, XP_005253841.1:p.Gly409Arg, XP_005253842.1:p.Gly409Arg, XP_005253843.1:p.Gly406Arg, XP_005253844.1:p.Gly409Arg, XP_011519325.1:p.Gly406Arg, XP_016875416.1:p.Gly462Arg, XP_016875417.1:p.Gly462Arg, XP_016875418.1:p.Gly462Arg, XP_016875419.1:p.Gly462Arg, XP_016875420.1:p.Gly462Arg, XP_016875422.1:p.Gly462Arg, XP_016875424.1:p.Gly462Arg, XP_016875425.1:p.Gly462Arg, XP_016875426.1:p.Gly462Arg, XP_016875427.1:p.Gly462Arg, XP_016875428.1:p.Gly462Arg, XP_016875429.1:p.Gly462Arg, XP_016875430.1:p.Gly462Arg, XP_016875431.1:p.Gly462Arg, XP_016875433.1:p.Gly462Arg, XP_016875434.1:p.Gly462Arg, XP_016875437.1:p.Gly462Arg, XP_016875440.1:p.Gly459Arg, XP_016875441.1:p.Gly462Arg, XP_016875444.1:p.Gly462Arg

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center