Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs1468412 [Homo sapiens]
    TCAGCTTGCAATGTTATAGGCAGTA[A/T]AATGATTGTTATCTCATAATGCATA
    Chromosome:
    7:86804135
    Gene:
    GRM3 (GeneView) LOC107986814 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    T=0.3796/1901
    HGVS:
    NC_000007.13:g.86433451A>T, NC_000007.14:g.86804135A>T, NM_000840.2:c.1324+17019A>T, XM_005250286.1:c.1324+17019A>T, XM_005250287.1:c.940+17019A>T, XM_005250288.1:c.1324+17019A>T, XM_005250289.1:c.101-34704A>T, XM_005250290.1:c.1324+17019A>T, XM_011516088.1:c.1324+17019A>T, XR_001745257.1:n.-699T>A
    2.

    rs917071 [Homo sapiens]
      AATTGAAGACTCAATTTCCATATTG[C/T]AGAGTTGTTTTCCTAGGAGCCCTTT
      Chromosome:
      7:86724465
      Gene:
      GRM3 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      T=0.3954/1980
      HGVS:
      NC_000007.13:g.86353781C>T, NC_000007.14:g.86724465C>T, NM_000840.2:c.-140-40541C>T, XM_005250287.1:c.85-61796C>T, XM_005250289.1:c.100+79593C>T, XM_011516088.1:c.-140-40541C>T, XM_017012073.1:c.-140-40541C>T
      3.

      rs187993 [Homo sapiens]
        TTCAAACTTTATATGTTCTACAGCA[G/T]CCATCTGTGGTGATAATCAAGCAGG
        Chromosome:
        7:86634364
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.4307/2157
        HGVS:
        NC_000007.13:g.86263680T>G, NC_000007.14:g.86634364T>G

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center