Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

1.

rs35045067 [Homo sapiens]
    GGATTACCCCTTCTGATTGACAACT[A/G]TGTGCCCCCTTTGGAGGGACTGCCT
    Chromosome:
    3:37048557
    Gene:
    MLH1 (GeneView)
    Functional Consequence:
    intron variant,missense
    Allele Origin:
    G(germline)/A(germline)/C(germline)
    Clinical significance:
    Uncertain significance
    Validated:
    no info
    HGVS:
    NC_000003.11:g.37090048A>C, NC_000003.11:g.37090048A>G, NC_000003.12:g.37048557A>C, NC_000003.12:g.37048557A>G, NG_007109.2:g.60208A>C, NG_007109.2:g.60208A>G, NM_000249.3:c.1937A>C, NM_000249.3:c.1937A>G, NM_001167617.1:c.1643A>C, NM_001167617.1:c.1643A>G, NM_001167618.1:c.1214A>C, NM_001167618.1:c.1214A>G, NM_001167619.1:c.1214A>C, NM_001167619.1:c.1214A>G, NM_001258271.1:c.1896+874A>C, NM_001258271.1:c.1896+874A>G, NM_001258273.1:c.1214A>C, NM_001258273.1:c.1214A>G, NM_001258274.1:c.1214A>C, NM_001258274.1:c.1214A>G, NP_000240.1:p.Tyr646Cys, NP_000240.1:p.Tyr646Ser, NP_001161089.1:p.Tyr548Cys, NP_001161089.1:p.Tyr548Ser, NP_001161090.1:p.Tyr405Cys, NP_001161090.1:p.Tyr405Ser, NP_001161091.1:p.Tyr405Cys, NP_001161091.1:p.Tyr405Ser, NP_001245202.1:p.Tyr405Cys, NP_001245202.1:p.Tyr405Ser, NP_001245203.1:p.Tyr405Cys, NP_001245203.1:p.Tyr405Ser, XM_005265161.1:c.1730A>C, XM_005265161.1:c.1730A>G, XM_005265162.1:c.1643A>C, XM_005265162.1:c.1643A>G, XM_005265163.1:c.1214A>C, XM_005265163.1:c.1214A>G, XM_005265164.1:c.1214A>C, XM_005265164.1:c.1214A>G, XM_005265165.1:c.1214A>C, XM_005265165.1:c.1214A>G, XM_005265166.1:c.914A>C, XM_005265166.1:c.914A>G, XM_011533727.1:c.863A>C, XM_011533727.1:c.863A>G, XM_017006449.1:c.914A>C, XM_017006449.1:c.914A>G, XM_017006450.1:c.914A>C, XM_017006450.1:c.914A>G, XM_017006451.1:c.863A>C, XM_017006451.1:c.863A>G, XP_005265218.1:p.Tyr577Cys, XP_005265218.1:p.Tyr577Ser, XP_005265219.1:p.Tyr548Cys, XP_005265219.1:p.Tyr548Ser, XP_005265220.1:p.Tyr405Cys, XP_005265220.1:p.Tyr405Ser, XP_005265221.1:p.Tyr405Cys, XP_005265221.1:p.Tyr405Ser, XP_005265222.1:p.Tyr405Cys, XP_005265222.1:p.Tyr405Ser, XP_005265223.1:p.Tyr305Cys, XP_005265223.1:p.Tyr305Ser, XP_011532029.1:p.Tyr288Cys, XP_011532029.1:p.Tyr288Ser, XP_016861938.1:p.Tyr305Cys, XP_016861938.1:p.Tyr305Ser, XP_016861939.1:p.Tyr305Cys, XP_016861939.1:p.Tyr305Ser, XP_016861940.1:p.Tyr288Cys, XP_016861940.1:p.Tyr288Ser
    3.

    rs1805319 [Homo sapiens]
      GTGAAGAGTACGGTTTGAGCTGTTC[C/G]GATGCTCTGCATAATCTTTTTTAGT
      Chromosome:
      7:5997349
      Gene:
      PMS2 (GeneView)
      Functional Consequence:
      nc transcript variant,synonymous codon,utr variant 5 prime
      Allele Origin:
      G(germline)/T(germline)/A(germline)/C(germline)
      Clinical significance:
      Likely benign
      Validated:
      no info
      Global MAF:
      G=0.1687/845
      HGVS:
      NC_000007.13:g.6036980G>A, NC_000007.13:g.6036980G>C, NC_000007.13:g.6036980G>T, NC_000007.14:g.5997349G>A, NC_000007.14:g.5997349G>C, NC_000007.14:g.5997349G>T, NG_008466.1:g.16758C>A, NG_008466.1:g.16758C>G, NG_008466.1:g.16758C>T, NM_000535.5:c.780C>G, NM_000535.5:c.780C>T, NM_000535.6:c.780C>A, NM_000535.6:c.780C>G, NM_000535.6:c.780C>T, NM_001322003.1:c.375C>A, NM_001322003.1:c.375C>G, NM_001322003.1:c.375C>T, NM_001322004.1:c.375C>A, NM_001322004.1:c.375C>G, NM_001322004.1:c.375C>T, NM_001322005.1:c.375C>A, NM_001322005.1:c.375C>G, NM_001322005.1:c.375C>T, NM_001322006.1:c.780C>A, NM_001322006.1:c.780C>G, NM_001322006.1:c.780C>T, NM_001322007.1:c.462C>A, NM_001322007.1:c.462C>G, NM_001322007.1:c.462C>T, NM_001322008.1:c.462C>A, NM_001322008.1:c.462C>G, NM_001322008.1:c.462C>T, NM_001322009.1:c.375C>A, NM_001322009.1:c.375C>G, NM_001322009.1:c.375C>T, NM_001322010.1:c.375C>A, NM_001322010.1:c.375C>G, NM_001322010.1:c.375C>T, NM_001322011.1:c.-154C>A, NM_001322011.1:c.-154C>G, NM_001322011.1:c.-154C>T, NM_001322012.1:c.-154C>A, NM_001322012.1:c.-154C>G, NM_001322012.1:c.-154C>T, NM_001322013.1:c.207C>A, NM_001322013.1:c.207C>G, NM_001322013.1:c.207C>T, NM_001322014.1:c.780C>A, NM_001322014.1:c.780C>G, NM_001322014.1:c.780C>T, NM_001322015.1:c.471C>A, NM_001322015.1:c.471C>G, NM_001322015.1:c.471C>T, NP_000526.1:p.Ser260, NP_000526.2:p.Ser260, NP_001308932.1:p.Ser125, NP_001308933.1:p.Ser125, NP_001308934.1:p.Ser125, NP_001308935.1:p.Ser260, NP_001308936.1:p.Ser154, NP_001308937.1:p.Ser154, NP_001308938.1:p.Ser125, NP_001308939.1:p.Ser125, NP_001308942.1:p.Ser69, NP_001308943.1:p.Ser260, NP_001308944.1:p.Ser157, NR_003085.2:n.862C>A, NR_003085.2:n.862C>G, NR_003085.2:n.862C>T, NR_136154.1:n.867C>A, NR_136154.1:n.867C>G, NR_136154.1:n.867C>T, XM_017012342.1:c.-54C>A, XM_017012342.1:c.-54C>G, XM_017012342.1:c.-54C>T

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center