Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

1.

rs80356599 [Homo sapiens]
    CTGGTCCGAGTCTATGTGGTCCGGG[G/T]GAGACTCCCGTCGCTTTCCCTCCTT
    Chromosome:
    2:26466712
    Gene:
    OTOF (GeneView)
    Functional Consequence:
    splice donor variant
    Allele Origin:
    G(unknown)/T(germline,unknown)
    Clinical significance:
    Pathogenic
    Validated:
    no info
    HGVS:
    NC_000002.11:g.26689580A>C, NC_000002.12:g.26466712A>C, NG_009937.1:g.96987T>G, NM_001287489.1:c.4500+2T>G, NM_004802.3:c.2199+2T>G, NM_194248.2:c.4500+2T>G, NM_194322.2:c.2430+2T>G, NM_194323.2:c.2199+2T>G, XM_005264644.1:c.4485+2T>G, XM_005264645.1:c.2259+2T>G, XM_017005338.1:c.4440+2T>G

    Display Settings:

    Format
    Sort by

    Send to:

    Choose Destination

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center