Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs41313301 [Homo sapiens]
    GCGCTCTCCTCCCAATGTGCAACCC[A/G]ATGGAATCTGGCCTATTTCTGAGTG
    Chromosome:
    9:105635214
    Gene:
    FKTN (GeneView)
    Functional Consequence:
    downstream variant 500B,intron variant,missense,nc transcript variant,utr variant 3 prime
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.0052/26
    HGVS:
    NC_000009.11:g.108397495A>G, NC_000009.12:g.105635214A>G, NG_008754.1:g.82085A>G, NM_001079802.1:c.1336A>G, NM_001198963.1:c.1270+66A>G, NM_006731.2:c.1336A>G, NP_001073270.1:p.Asn446Asp, NP_006722.2:p.Asn446Asp, XM_005251803.1:c.1336A>G, XM_005251804.1:c.1336A>G, XM_005251805.1:c.1336A>G, XM_005251806.1:c.1333A>G, XM_006717014.2:c.*128A>G, XM_011518378.2:c.*120A>G, XM_011518391.2:c.*128A>G, XM_017014464.1:c.1270+66A>G, XM_017014465.1:c.1270+66A>G, XM_017014466.1:c.1336A>G, XM_017014467.1:c.1336A>G, XM_017014468.1:c.1336A>G, XM_017014469.1:c.1270+66A>G, XM_017014470.1:c.1270+66A>G, XM_017014471.1:c.1267A>G, XM_017014474.1:c.*128A>G, XM_017014476.1:c.940A>G, XM_017014477.1:c.940A>G, XM_017014478.1:c.940A>G, XM_017014479.1:c.940A>G, XP_005251860.1:p.Asn446Asp, XP_005251861.1:p.Asn446Asp, XP_005251862.1:p.Asn446Asp, XP_005251863.1:p.Asn445Asp, XP_016869955.1:p.Asn446Asp, XP_016869956.1:p.Asn446Asp, XP_016869957.1:p.Asn446Asp, XP_016869960.1:p.Asn423Asp, XP_016869965.1:p.Asn314Asp, XP_016869966.1:p.Asn314Asp, XP_016869967.1:p.Asn314Asp, XP_016869968.1:p.Asn314Asp, XR_001746242.1:n.1837+66A>G, XR_001746243.1:n.2022A>G, XR_001746244.1:n.1665+66A>G, XR_001746245.1:n.1722A>G, XR_001746246.1:n.1636A>G, XR_001746247.1:n.1458A>G, XR_001746248.1:n.2815A>G

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center