Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 38

1.

rs17886095 [Homo sapiens]
    CCCACCATGAGTCAGAGTGACTTTA[A/G]GAGATGCCTCTAGCAGACATCCCAT
    Chromosome:
    14:20472639
    Gene:
    PNP (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.0058/29
    HGVS:
    NC_000014.8:g.20940798G>A, NC_000014.9:g.20472639G>A, NG_009631.1:g.8257G>A, NM_000270.3:c.181+162G>A
    2.

    rs17885934 [Homo sapiens]
      TGGGATGTTCTGTCTTAATTCCAAG[A/C]CTGTTTGTTCCGCCTCCCAATAATT
      Chromosome:
      10:104262365
      Gene:
      GSTO1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by cluster
      HGVS:
      NC_000010.10:g.106022123C>A, NC_000010.11:g.104262365C>A, NG_023362.1:g.13172C>A, NM_001191002.1:c.366+2567C>A, NM_001191003.1:c.283-614C>A, NM_004832.2:c.367-614C>A
      3.

      rs17885917 [Homo sapiens]
        CAATGTTTCTACTCCTTGACCTAGC[A/G]TTTCACTGAAGACAAATGTTGTAAG
        Chromosome:
        14:20472576
        Gene:
        PNP (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        G=0.0042/21
        HGVS:
        NC_000014.8:g.20940735A>G, NC_000014.9:g.20472576A>G, NG_009631.1:g.8194A>G, NM_000270.3:c.181+99A>G
        4.

        rs17885859 [Homo sapiens]
          TCCTTTAAAGAAAGTTGTGTTGGCC[A/G]GGCGTGGTGGCTCAAGCCTGTAATC
          Chromosome:
          10:104262433
          Gene:
          GSTO1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by cluster,by frequency
          HGVS:
          NC_000010.10:g.106022191G>A, NC_000010.11:g.104262433G>A, NG_023362.1:g.13240G>A, NM_001191002.1:c.366+2635G>A, NM_001191003.1:c.283-546G>A, NM_004832.2:c.367-546G>A
          5.

          rs17885781 [Homo sapiens]
            TTCAGCTCTGTCACACCTCATTGCC[
            -/ACACCTCATTGC/CA
            ]CACCTCTGAAAGCAACGTTTGGTCT
            Chromosome:
            14:20470562
            Gene:
            PNP (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency
            HGVS:
            NC_000014.8:g.20938721_20938722insACACCTCATTGC, NC_000014.8:g.20938721_20938722insCA, NC_000014.9:g.20470562_20470563insACACCTCATTGC, NC_000014.9:g.20470562_20470563insCA, NG_009631.1:g.6180_6181insACACCTCATTGC, NG_009631.1:g.6180_6181insCA, NM_000270.3:c.11+1027_11+1028insACACCTCATTGC, NM_000270.3:c.11+1027_11+1028insCA
            6.

            rs17885679 [Homo sapiens]
              AAGGATGACTCCTAGACCTGTCTTT[A/G/T]TCCCATACTTGGGAAGATAAGCTGT
              Chromosome:
              10:104254219
              Gene:
              GSTO1 (GeneView)
              Functional Consequence:
              upstream variant 2KB,utr variant 5 prime
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              A=0.0002/1
              HGVS:
              NC_000010.10:g.106013977G>A, NC_000010.11:g.104254219G>A, NC_000010.11:g.104254219G>T, NG_023362.1:g.5026G>A, NG_023362.1:g.5026G>T, NM_001191002.1:c.-710G>A, NM_001191002.1:c.-710G>T, NM_001191003.1:c.-331G>A, NM_001191003.1:c.-331G>T, NM_004832.2:c.-710G>A, NM_004832.2:c.-710G>T
              7.
              8.

              rs17884106 [Homo sapiens]
                ACAGTCCTGTGCTCACTTCCCCCAC[C/T]CCACGCCTTTGAAAACTCTTCTCTC
                Chromosome:
                14:20470138
                Gene:
                PNP (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                no info
                HGVS:
                NC_000014.8:g.20938297C>T, NC_000014.9:g.20470138C>T, NG_009631.1:g.5756C>T, NM_000270.3:c.11+603C>T
                9.

                rs17883604 [Homo sapiens]
                  GTCTTGAACTCCTGGCCTGTTGATC[C/T]GCCTGTCTTGGGCTCCCGAAGTGCT
                  Chromosome:
                  14:20473806
                  Gene:
                  PNP (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  T=0.0030/15
                  HGVS:
                  NC_000014.8:g.20941965C>T, NC_000014.9:g.20473806C>T, NG_009631.1:g.9424C>T, NM_000270.3:c.182-666C>T
                  10.

                  rs17883384 [Homo sapiens]
                    TTTGTTCCGCCTCCCAATAATTCTA[C/T]GAGCCACTCAGTCTCCTTTAAAGAA
                    Chromosome:
                    10:104262394
                    Gene:
                    GSTO1 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency
                    Global MAF:
                    C=0.0044/22
                    HGVS:
                    NC_000010.10:g.106022152T>C, NC_000010.11:g.104262394T>C, NG_023362.1:g.13201T>C, NM_001191002.1:c.366+2596T>C, NM_001191003.1:c.283-585T>C, NM_004832.2:c.367-585T>C
                    11.

                    rs17883294 [Homo sapiens]
                      GAGGAGGCAGGTAATTAAGTTAGGG[A/C]AATAGATAAGAATACATGTTTTGAG
                      Chromosome:
                      14:20473499
                      Gene:
                      PNP (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      no info
                      HGVS:
                      NC_000014.8:g.20941658C>A, NC_000014.9:g.20473499C>A, NG_009631.1:g.9117C>A, NM_000270.3:c.182-973C>A
                      12.

                      rs17883126 [Homo sapiens]
                        AATTAATTTTATTACTTTTAAATAG[C/T]CACACATGGCTAGTGCCTTCTGTTT
                        Chromosome:
                        14:20467112
                        Validated:
                        by 1000G,by cluster,by frequency
                        Global MAF:
                        T=0.0056/28
                        HGVS:
                        NC_000014.8:g.20935271C>T, NC_000014.9:g.20467112C>T, NG_009631.1:g.2730C>T
                        13.

                        rs17882836 [Homo sapiens]
                          TTCAGATTGAGCCTATAAGATAGAT[A/G/T]GGGCCAATTTACATCCCTTGTTTAT
                          Chromosome:
                          14:20470880
                          Gene:
                          PNP (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency
                          Global MAF:
                          A=0.0040/20
                          HGVS:
                          NC_000014.8:g.20939039G>A, NC_000014.8:g.20939039G>T, NC_000014.9:g.20470880G>A, NC_000014.9:g.20470880G>T, NG_009631.1:g.6498G>A, NG_009631.1:g.6498G>T, NM_000270.3:c.11+1345G>A, NM_000270.3:c.11+1345G>T
                          14.

                          rs17882804 [Homo sapiens]
                            TTTGTCAACTTTATTACTGTTTTTG[-/TTTTG]TTTTGTTTTTTTGCATAAGCTCCTC
                            Chromosome:
                            14:20473144
                            Gene:
                            PNP (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by cluster,by frequency
                            HGVS:
                            NC_000014.8:g.20941303_20941304insTTTTG, NC_000014.9:g.20473144_20473145insTTTTG, NG_009631.1:g.8762_8763insTTTTG, NM_000270.3:c.181+667_181+668insTTTTG
                            15.

                            rs17881554 [Homo sapiens]
                              ACGACCGGACTATGAGGCAGAGGGC[A/T]CTCAGTACCTGGAAACAAATGGGGG
                              Chromosome:
                              14:20475122
                              Gene:
                              PNP (GeneView)
                              Functional Consequence:
                              synonymous codon
                              Validated:
                              no info
                              HGVS:
                              NC_000014.8:g.20943281T>A, NC_000014.9:g.20475122T>A, NG_009631.1:g.10740T>A, NM_000270.3:c.522T>A, NP_000261.2:p.Ala174
                              16.

                              rs17881537 [Homo sapiens]
                                TCTTACATAGACACTTCTCAGGCTG[C/G]GCATGGTAGCTCACGCCTATAACCC
                                Chromosome:
                                10:104258600
                                Gene:
                                GSTO1 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by cluster
                                HGVS:
                                NC_000010.10:g.106018358G>C, NC_000010.11:g.104258600G>C, NG_023362.1:g.9407G>C, NM_001191002.1:c.144-976G>C, NM_001191003.1:c.60-976G>C, NM_004832.2:c.144-976G>C
                                17.

                                rs17881431 [Homo sapiens]
                                  CCCCCTTGTTCAGTAGCCTCTTCTT[A/T]AAGAAGCCAGAGTAAGTATACTRTG
                                  Chromosome:
                                  14:20473431
                                  Gene:
                                  PNP (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by cluster,by frequency
                                  HGVS:
                                  NC_000014.8:g.20941590T>A, NC_000014.9:g.20473431T>A, NG_009631.1:g.9049T>A, NM_000270.3:c.181+954T>A
                                  18.

                                  rs17881389 [Homo sapiens]
                                    TCCCTTCACAAGCTGAACAGGAGCC[A/T]TTGGAGAGAACGCTCTGGACCGGTG
                                    Chromosome:
                                    10:104254477
                                    Gene:
                                    GSTO1 (GeneView)
                                    Functional Consequence:
                                    upstream variant 2KB,utr variant 5 prime
                                    Validated:
                                    by 1000G,by cluster,by frequency
                                    Global MAF:
                                    A=0.0008/4
                                    HGVS:
                                    NC_000010.10:g.106014235T>A, NC_000010.11:g.104254477T>A, NG_023362.1:g.5284T>A, NM_001191002.1:c.-452T>A, NM_001191003.1:c.-73T>A, NM_004832.2:c.-452T>A
                                    19.

                                    rs17881356 [Homo sapiens]
                                      TGGCCTTTATATATAAATTTTTTTT[A/T]AATTTTTTAAATTAAAAATTAAATG
                                      Chromosome:
                                      14:20468575
                                      Gene:
                                      PNP (GeneView)
                                      Functional Consequence:
                                      upstream variant 2KB
                                      Validated:
                                      by 1000G,by cluster,by frequency
                                      Global MAF:
                                      A=0.0433/217
                                      HGVS:
                                      NC_000014.8:g.20936734T>A, NC_000014.9:g.20468575T>A, NG_009631.1:g.4193T>A, NM_000270.3:c.-950T>A
                                      20.

                                      rs17881345 [Homo sapiens]
                                        GCATTACAGGCGCGACGCACTGTGC[C/T]TGGCCAATGTGATGACTGTTTCTAA
                                        Chromosome:
                                        14:20475780
                                        Gene:
                                        PNP (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by 1000G,by cluster,by frequency
                                        Global MAF:
                                        T=0.0044/22
                                        HGVS:
                                        NC_000014.8:g.20943939C>T, NC_000014.9:g.20475780C>T, NG_009631.1:g.11398C>T, NM_000270.3:c.652+528C>T

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center