Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs11571324 [Homo sapiens]
    ATGGCAAAGCTGGCCTTAGGCAGAG[G/T]TGTCTGAGAGGGACTGTCAAAAAGA
    Chromosome:
    2:203872137
    Gene:
    CTLA4 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0006/3
    HGVS:
    NC_000002.11:g.204736860C>A, NC_000002.12:g.203872137C>A, NG_011502.1:g.9352C>A, NM_001037631.2:c.458-571C>A, NM_005214.4:c.568-571C>A, XR_241294.1:n.708-571C>A
    2.

    rs11571318 [Homo sapiens]
      GTCCCTAGCTGGTTAAAAATGAATG[C/T]TCACAGCATACAGAATTATAAACCT
      Chromosome:
      2:203872598
      Gene:
      CTLA4 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.0052/26
      HGVS:
      NC_000002.11:g.204737321A>G, NC_000002.12:g.203872598A>G, NG_011502.1:g.9813A>G, NM_001037631.2:c.458-110A>G, NM_005214.4:c.568-110A>G, XR_241294.1:n.708-110A>G
      3.

      rs7565213 [Homo sapiens]
        GCGGACCTCTTGAGGTCAGGAGTTC[A/G]AGACCAGCCTGGCCAACATGGTGAA
        Chromosome:
        2:203878686
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        A=0.4293/2150
        HGVS:
        NC_000002.11:g.204743409G>A, NC_000002.12:g.203878686G>A

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center