Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 63

1.

rs3092995 [Homo sapiens]
    CCACAGGTACAGAGCCACAGGACCC[C/G/T]AAGAATGAGCTTACAAAGTGGCCTT
    Chromosome:
    17:43045642
    Gene:
    BRCA1 (GeneView)
    Functional Consequence:
    downstream variant 500B,nc transcript variant,utr variant 3 prime
    Allele Origin:
    G(germline)/C(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0156/78
    HGVS:
    NC_000017.10:g.41197659G>A, NC_000017.10:g.41197659G>C, NC_000017.11:g.43045642G>A, NC_000017.11:g.43045642G>C, NG_005905.2:g.172342C>G, NG_005905.2:g.172342C>T, NM_007294.3:c.*36C>G, NM_007294.3:c.*36C>T, NM_007297.3:c.*36C>G, NM_007297.3:c.*36C>T, NM_007298.3:c.*36C>G, NM_007298.3:c.*36C>T, NM_007299.3:c.*142C>G, NM_007299.3:c.*142C>T, NM_007300.3:c.*36C>G, NM_007300.3:c.*36C>T, NR_027676.1:n.5764C>G, NR_027676.1:n.5764C>T, U14680.1:c.*36C>G, U14680.1:c.*36C>T
    2.

    rs3092994 [Homo sapiens]
      TCAGAATTGCATTTTTACACCTAAC[A/G]TTTAACACCTAAGGTTTTTGCTGAT
      Chromosome:
      17:43063808
      Gene:
      BRCA1 (GeneView)
      Functional Consequence:
      intron variant
      Allele Origin:
      G(germline)/A(germline,somatic)
      Clinical significance:
      untested
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.3425/1715
      HGVS:
      NC_000017.10:g.41215825C>T, NC_000017.11:g.43063808C>T, NG_005905.2:g.154176G>A, NM_007294.3:c.5152+66G>A, NM_007297.3:c.5011+66G>A, NM_007298.3:c.1840+66G>A, NM_007299.3:c.1840+66G>A, NM_007300.3:c.5215+66G>A, NR_027676.1:n.5288+66G>A, U14680.1:c.5152+66G>A
      6.

      rs3092990 [Homo sapiens]
        TTTTGCAATTTAATACCTAATCGAC[-/T]TGTGATCACATTTCCTTTCTTTACA
        Chromosome:
        13:32364618
        Gene:
        BRCA2 (GeneView)
        Functional Consequence:
        intron variant
        Clinical significance:
        Benign
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        T=0.2105/1054
        HGVS:
        NC_000013.10:g.32938755_32938756insT, NC_000013.11:g.32364618_32364619insT, NG_012772.3:g.54139_54140insT, NM_000059.3:c.8331+1085_8331+1086insT, U43746.1:c.8331+1085_8331+1086insT
        7.

        rs3092989 [Homo sapiens]
          AACATGAGCTGGAGCAAAAAGAAAG[A/G]GATGGGGGACTTGGAGTAGGCATAG
          Chromosome:
          13:32315226
          Gene:
          BRCA2 (GeneView)
          Functional Consequence:
          intron variant,upstream variant 2KB
          Clinical significance:
          Benign
          Validated:
          by 1000G,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          A=0.1595/799
          HGVS:
          NC_000013.10:g.32889363G>A, NC_000013.11:g.32315226G>A, NG_012772.3:g.4747G>A, NG_017006.1:g.1729C>T, NM_000059.3:c.-481G>A, U43746.1:c.-227-254G>A
          8.

          rs3092988 [Homo sapiens]
            CCTTTCCCTGCTGAGTCTCTAACCA[A/G]GATAACATGTATTTTTTTGACTGGA
            Chromosome:
            17:43049685
            Gene:
            BRCA1 (GeneView)
            Functional Consequence:
            intron variant
            Clinical significance:
            Benign
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.3251/1628
            HGVS:
            NC_000017.10:g.41201702C>T, NC_000017.11:g.43049685C>T, NG_005905.2:g.168299G>A, NM_007294.3:c.5333-491G>A, NM_007297.3:c.5192-491G>A, NM_007298.3:c.2021-491G>A, NM_007299.3:c.2020+1378G>A, NM_007300.3:c.5396-491G>A, NR_027676.1:n.5469-491G>A, U14680.1:c.5333-491G>A
            9.

            rs3092987 [Homo sapiens]
              ATATTTACTTGAGAAAATAATTATT[A/G]AATATTAGTGGAAAAGCTATACTTT
              Chromosome:
              17:43070706
              Gene:
              BRCA1 (GeneView)
              Functional Consequence:
              intron variant
              Clinical significance:
              Benign
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              C=0.3375/1690
              HGVS:
              NC_000017.10:g.41222723T>C, NC_000017.11:g.43070706T>C, NG_005905.2:g.147278A>G, NM_007294.3:c.4986+222A>G, NM_007297.3:c.4845+222A>G, NM_007298.3:c.1674+222A>G, NM_007299.3:c.1674+222A>G, NM_007300.3:c.5049+222A>G, NR_027676.1:n.5122+222A>G, U14680.1:c.4986+222A>G
              10.

              rs3092986 [Homo sapiens]
                CGAAAACATAACAACACTCCAGTCC[A/G]TAACTGTTGACAAGTACAAGCGCGC
                Chromosome:
                17:43125979
                Gene:
                BRCA1 (GeneView) NBR2 (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Clinical significance:
                Benign
                Validated:
                by 1000G,by cluster,by frequency
                Global MAF:
                C=0.0218/109
                HGVS:
                NC_000017.10:g.41277996T>C, NC_000017.11:g.43125979T>C, NG_005905.2:g.92005A>G, NM_007294.3:c.-728A>G, NM_007297.3:c.-809A>G, NM_007298.3:c.-1883A>G, NM_007299.3:c.-722A>G, NM_007300.3:c.-728A>G, NR_003108.2:n.214+209T>C, NR_027676.1:n.-656A>G, NR_138145.1:n.214+209T>C, U14680.1:c.-729A>G
                11.

                rs3092985 [Homo sapiens]
                  GAACATATTTTATATTTCAGGGCCC[C/T]TGTTTGCTTTTTTTCAATAAGTAAA
                  Chromosome:
                  15:40783204
                  Gene:
                  DNAJC17 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  C=0.4159/2083
                  HGVS:
                  NC_000015.10:g.40783204C>T, NC_000015.9:g.41075402C>T, NM_018163.2:c.79-3207G>A, XM_005254533.1:c.91-3207G>A, XM_017022401.1:c.91-3207G>A, XM_017022402.1:c.91-3207G>A
                  12.

                  rs3092984 [Homo sapiens]
                    ATGAAGGACTCAGTTACACACATCT[C/G]TCCTCCTGGCAATTAAGTTTCTCTT
                    Chromosome:
                    15:40747806
                    Gene:
                    RMDN3 (GeneView)
                    Functional Consequence:
                    intron variant,utr variant 5 prime
                    Validated:
                    by hapmap
                    HGVS:
                    NC_000015.10:g.40747806C>G, NC_000015.9:g.41040004C>G, NM_001304802.1:c.525-2547G>C, NM_001323894.1:c.525-2547G>C, NM_001323895.1:c.138-2547G>C, NM_001323896.1:c.525-2547G>C, NM_001323897.1:c.525-2547G>C, NM_018145.2:c.525-2547G>C, XM_005254531.1:c.525-2547G>C, XM_005254532.1:c.525-2547G>C, XM_011521755.2:c.-270G>C
                    15.

                    rs3092981 [Homo sapiens]
                      TGCTCAGCGGCAGTTGGGGCCTCCG[C/T]GCGCAGTGTGAAACCCGGACGTGGC
                      Chromosome:
                      15:40695527
                      Gene:
                      RAD51-AS1 (GeneView) RAD51 (GeneView)
                      Functional Consequence:
                      intron variant,upstream variant 2KB,utr variant 5 prime
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      T=0.0379/190
                      HGVS:
                      NC_000015.10:g.40695527C>T, NC_000015.9:g.40987725C>T, NG_012120.1:g.5367C>T, NM_001164269.1:c.-3+206C>T, NM_001164270.1:c.-3+102C>T, NM_002875.4:c.-3+102C>T, NM_133487.3:c.-3+102C>T, NR_040058.1:n.-422G>A, XM_006720626.3:c.-336C>T, XM_011521857.2:c.-3+707C>T, XM_011521858.2:c.-102C>T, XM_011521859.2:c.-341C>T, XM_011521860.2:c.-3+206C>T, XM_011521861.2:c.-3+707C>T, XM_011521862.2:c.-257+102C>T
                      16.

                      rs3092980 [Homo sapiens]
                        ATTTTCTCCCAGTCCAGTGGAAAAA[C/T]ATTAGCAGCTGCTGTTGGTACTGTT
                        Chromosome:
                        15:40651905
                        Gene:
                        CASC5 (GeneView) KNL1 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        T=0.0060/30
                        HGVS:
                        NC_000015.10:g.40651905C>T, NC_000015.9:g.40944103C>T, NG_033114.1:g.62657C>T, NM_144508.4:c.6315-100C>T, NM_170589.4:c.6393-100C>T, XM_017022432.1:c.5991-100C>T
                        17.

                        rs3092979 [Homo sapiens]
                          AAGTTTCATTAACTAAGAGCCTGTC[A/G]TTTTCTAATTTATAATATGAATAAG
                          Chromosome:
                          15:40645449
                          Gene:
                          CASC5 (GeneView) KNL1 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          G=0.3496/1751
                          HGVS:
                          NC_000015.10:g.40645449A>G, NC_000015.9:g.40937647A>G, NG_033114.1:g.56201A>G, NM_144508.4:c.5890-207A>G, NM_170589.4:c.5968-207A>G, XM_017022432.1:c.5566-207A>G
                          18.

                          rs3092978 [Homo sapiens]
                            GGGGAAGGATAGGAACAGGGAGGAT[A/G]TTGGCAGGGTGAAGGAGGGAGAGGA
                            Chromosome:
                            15:40634781
                            Gene:
                            CASC5 (GeneView) KNL1 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.3458/1732
                            HGVS:
                            NC_000015.10:g.40634781A>G, NC_000015.9:g.40926979A>G, NG_033114.1:g.45533A>G, NM_144508.4:c.5682+5410A>G, NM_170589.4:c.5760+5410A>G, XM_017022432.1:c.5358+5410A>G
                            19.

                            rs3072040 [Homo sapiens]
                              TTATTCAGTAGACTTGGTATGCTAA[-/CAAT]TAAGAGTGTTATAAACTATGTCTTT
                              Chromosome:
                              13:32341273
                              Gene:
                              BRCA2 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by cluster
                              HGVS:
                              NC_000013.10:g.32915410_32915413delCAAT, NC_000013.11:g.32341273_32341276delCAAT, NG_012772.3:g.30794_30797delCAAT, NM_000059.3:c.6841+77_6841+80delCAAT, U43746.1:c.6841+77_6841+80delCAAT
                              20.

                              rs2289219 [Homo sapiens]
                                GCCCAGGTAGGAAGAGCTCCGAGAC[C/T]TGAGCGCCCAGCCGGGCGAGGCCTG
                                Chromosome:
                                15:40773692
                                Gene:
                                DNAJC17 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap
                                Global MAF:
                                T=0.1743/873
                                HGVS:
                                NC_000015.10:g.40773692C>T, NC_000015.9:g.41065890C>T, NM_018163.2:c.792+35G>A, XM_005254533.1:c.804+35G>A, XM_017022401.1:c.804+35G>A

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center