Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs80358277 [Homo sapiens]
    TCCTCCTACGCCGACTCGCTCTGGT[C/G]GGGGACGGTGCGTGAGGGTCTTTGT
    Chromosome:
    1:40819465
    Gene:
    KCNQ4 (GeneView)
    Functional Consequence:
    missense,utr variant 5 prime
    Allele Origin:
    G(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000001.10:g.41285137G>C, NC_000001.11:g.40819465G>C, NG_008139.1:g.40454G>C, NM_004700.3:c.827G>C, NM_172163.2:c.827G>C, NP_004691.2:p.Trp276Ser, NP_751895.1:p.Trp276Ser, XM_017002792.1:c.-191G>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center