Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 9

1.

rs121918794 [Homo sapiens]
    AAGGTTTTCACTTACATTTTCATTC[C/T]GGAAATGCTTCTAAAATGGGTGGCA
    Chromosome:
    2:166012194
    Gene:
    LOC102724058 (GeneView) SCN1A (GeneView)
    Functional Consequence:
    intron variant,missense,nc transcript variant
    Allele Origin:
    T(germline)/C(germline,unknown)
    Clinical significance:
    untested
    Validated:
    no info
    HGVS:
    AB093548.1:c.3794T>C, BAC21101.1:p.Leu1265Pro, NC_000002.11:g.166868704A>G, NC_000002.12:g.166012194A>G, NG_011906.1:g.66446T>C, NM_001165963.1:c.3794T>C, NM_001165964.1:c.3710T>C, NM_001202435.1:c.3794T>C, NM_006920.4:c.3761T>C, NP_001159435.1:p.Leu1265Pro, NP_001159436.1:p.Leu1237Pro, NP_001189364.1:p.Leu1265Pro, NP_008851.3:p.Leu1254Pro, NR_110598.1:n.176-3419A>G, XM_011511602.2:c.3794T>C, XM_011511604.2:c.3761T>C, XM_011511605.2:c.3758T>C, XM_011511606.2:c.3710T>C, XM_017004644.1:c.3794T>C, XM_017004645.1:c.3761T>C, XM_017004646.1:c.3761T>C, XM_017004647.1:c.3761T>C, XM_017004648.1:c.3761T>C, XM_017004649.1:c.3761T>C, XM_017004650.1:c.3758T>C, XM_017004651.1:c.3710T>C, XM_017004652.1:c.3710T>C, XM_017004653.1:c.3707T>C, XM_017004654.1:c.1352T>C, XP_011509904.1:p.Leu1265Pro, XP_011509906.1:p.Leu1254Pro, XP_011509907.1:p.Leu1253Pro, XP_011509908.1:p.Leu1237Pro, XP_016860133.1:p.Leu1265Pro, XP_016860134.1:p.Leu1254Pro, XP_016860135.1:p.Leu1254Pro, XP_016860136.1:p.Leu1254Pro, XP_016860137.1:p.Leu1254Pro, XP_016860138.1:p.Leu1254Pro, XP_016860139.1:p.Leu1253Pro, XP_016860140.1:p.Leu1237Pro, XP_016860141.1:p.Leu1237Pro, XP_016860142.1:p.Leu1236Pro, XP_016860143.1:p.Leu451Pro, XR_001738883.1:n.4180T>C, XR_001738884.1:n.4152T>C, XR_001738885.1:n.4144T>C
    2.

    rs121918793 [Homo sapiens]
      GTCTCCTATCAGCCAATCACTACTA[C/T]TTTAAAACGAAAACAAGAGGAAGTA
      Chromosome:
      2:165991549
      Gene:
      LOC102724058 (GeneView) SCN1A (GeneView)
      Functional Consequence:
      intron variant,missense,nc transcript variant
      Allele Origin:
      T(unknown)/C(germline,unknown)
      Clinical significance:
      Likely pathogenic
      Validated:
      no info
      HGVS:
      AB093548.1:c.5726C>T, BAC21101.1:p.Thr1909Ile, NC_000002.11:g.166848059G>A, NC_000002.12:g.165991549G>A, NG_011906.1:g.87091C>T, NM_001165963.1:c.5726C>T, NM_001165964.1:c.5642C>T, NM_001202435.1:c.5726C>T, NM_006920.4:c.5693C>T, NP_001159435.1:p.Thr1909Ile, NP_001159436.1:p.Thr1881Ile, NP_001189364.1:p.Thr1909Ile, NP_008851.3:p.Thr1898Ile, NR_110598.1:n.176-24064G>A, XM_011511602.2:c.5726C>T, XM_011511604.2:c.5693C>T, XM_011511605.2:c.5690C>T, XM_011511606.2:c.5642C>T, XM_017004644.1:c.5726C>T, XM_017004645.1:c.5693C>T, XM_017004646.1:c.5693C>T, XM_017004647.1:c.5693C>T, XM_017004648.1:c.5693C>T, XM_017004649.1:c.5693C>T, XM_017004650.1:c.5690C>T, XM_017004651.1:c.5642C>T, XM_017004652.1:c.5642C>T, XM_017004653.1:c.5639C>T, XM_017004654.1:c.3284C>T, XP_011509904.1:p.Thr1909Ile, XP_011509906.1:p.Thr1898Ile, XP_011509907.1:p.Thr1897Ile, XP_011509908.1:p.Thr1881Ile, XP_016860133.1:p.Thr1909Ile, XP_016860134.1:p.Thr1898Ile, XP_016860135.1:p.Thr1898Ile, XP_016860136.1:p.Thr1898Ile, XP_016860137.1:p.Thr1898Ile, XP_016860138.1:p.Thr1898Ile, XP_016860139.1:p.Thr1897Ile, XP_016860140.1:p.Thr1881Ile, XP_016860141.1:p.Thr1881Ile, XP_016860142.1:p.Thr1880Ile, XP_016860143.1:p.Thr1095Ile, XR_001738883.1:n.6176C>T, XR_001738884.1:n.6148C>T, XR_001738885.1:n.6140C>T
      3.

      rs121918792 [Homo sapiens]
        GTCCCTTCCTGCGTTGTTTAACATC[C/G]GCCTCCTACTCTTCCTAGTCATGTT
        Chromosome:
        2:165992255
        Gene:
        LOC102724058 (GeneView) SCN1A (GeneView)
        Functional Consequence:
        intron variant,missense,nc transcript variant
        Allele Origin:
        G(germline)/C(germline,unknown)
        Clinical significance:
        untested
        Validated:
        no info
        HGVS:
        AB093548.1:c.5020G>C, BAC21101.1:p.Gly1674Arg, NC_000002.11:g.166848765C>G, NC_000002.12:g.165992255C>G, NG_011906.1:g.86385G>C, NM_001165963.1:c.5020G>C, NM_001165964.1:c.4936G>C, NM_001202435.1:c.5020G>C, NM_006920.4:c.4987G>C, NP_001159435.1:p.Gly1674Arg, NP_001159436.1:p.Gly1646Arg, NP_001189364.1:p.Gly1674Arg, NP_008851.3:p.Gly1663Arg, NR_110598.1:n.176-23358C>G, XM_011511602.2:c.5020G>C, XM_011511604.2:c.4987G>C, XM_011511605.2:c.4984G>C, XM_011511606.2:c.4936G>C, XM_017004644.1:c.5020G>C, XM_017004645.1:c.4987G>C, XM_017004646.1:c.4987G>C, XM_017004647.1:c.4987G>C, XM_017004648.1:c.4987G>C, XM_017004649.1:c.4987G>C, XM_017004650.1:c.4984G>C, XM_017004651.1:c.4936G>C, XM_017004652.1:c.4936G>C, XM_017004653.1:c.4933G>C, XM_017004654.1:c.2578G>C, XP_011509904.1:p.Gly1674Arg, XP_011509906.1:p.Gly1663Arg, XP_011509907.1:p.Gly1662Arg, XP_011509908.1:p.Gly1646Arg, XP_016860133.1:p.Gly1674Arg, XP_016860134.1:p.Gly1663Arg, XP_016860135.1:p.Gly1663Arg, XP_016860136.1:p.Gly1663Arg, XP_016860137.1:p.Gly1663Arg, XP_016860138.1:p.Gly1663Arg, XP_016860139.1:p.Gly1662Arg, XP_016860140.1:p.Gly1646Arg, XP_016860141.1:p.Gly1646Arg, XP_016860142.1:p.Gly1645Arg, XP_016860143.1:p.Gly860Arg, XR_001738883.1:n.5470G>C, XR_001738884.1:n.5442G>C, XR_001738885.1:n.5434G>C
        4.

        rs121918791 [Homo sapiens]
          TCTTGCTAGGATTGGCCGAATCCTA[C/T]GTCTGATCAAAGGAGCAAAGGGGAT
          Chromosome:
          2:165992333
          Gene:
          LOC102724058 (GeneView) SCN1A (GeneView)
          Functional Consequence:
          intron variant,missense,nc transcript variant
          Allele Origin:
          T(unknown)/C(germline,unknown)
          Clinical significance:
          Pathogenic
          Validated:
          no info
          HGVS:
          AB093548.1:c.4942C>T, BAC21101.1:p.Arg1648Cys, NC_000002.11:g.166848843G>A, NC_000002.12:g.165992333G>A, NG_011906.1:g.86307C>T, NM_001165963.1:c.4942C>T, NM_001165964.1:c.4858C>T, NM_001202435.1:c.4942C>T, NM_006920.4:c.4909C>T, NP_001159435.1:p.Arg1648Cys, NP_001159436.1:p.Arg1620Cys, NP_001189364.1:p.Arg1648Cys, NP_008851.3:p.Arg1637Cys, NR_110598.1:n.176-23280G>A, XM_011511602.2:c.4942C>T, XM_011511604.2:c.4909C>T, XM_011511605.2:c.4906C>T, XM_011511606.2:c.4858C>T, XM_017004644.1:c.4942C>T, XM_017004645.1:c.4909C>T, XM_017004646.1:c.4909C>T, XM_017004647.1:c.4909C>T, XM_017004648.1:c.4909C>T, XM_017004649.1:c.4909C>T, XM_017004650.1:c.4906C>T, XM_017004651.1:c.4858C>T, XM_017004652.1:c.4858C>T, XM_017004653.1:c.4855C>T, XM_017004654.1:c.2500C>T, XP_011509904.1:p.Arg1648Cys, XP_011509906.1:p.Arg1637Cys, XP_011509907.1:p.Arg1636Cys, XP_011509908.1:p.Arg1620Cys, XP_016860133.1:p.Arg1648Cys, XP_016860134.1:p.Arg1637Cys, XP_016860135.1:p.Arg1637Cys, XP_016860136.1:p.Arg1637Cys, XP_016860137.1:p.Arg1637Cys, XP_016860138.1:p.Arg1637Cys, XP_016860139.1:p.Arg1636Cys, XP_016860140.1:p.Arg1620Cys, XP_016860141.1:p.Arg1620Cys, XP_016860142.1:p.Arg1619Cys, XP_016860143.1:p.Arg834Cys, XR_001738883.1:n.5392C>T, XR_001738884.1:n.5364C>T, XR_001738885.1:n.5356C>T
          5.

          rs121918790 [Homo sapiens]
            ATTCCCCTTTGGTAGGTGGAACTCC[A/G]GCCTAAGTATGAAGAAAGTCTGTAC
            Chromosome:
            2:165998165
            Gene:
            LOC102724058 (GeneView) SCN1A (GeneView)
            Functional Consequence:
            intron variant,missense,nc transcript variant
            Allele Origin:
            G(unknown)/A(germline,unknown)
            Clinical significance:
            untested
            Validated:
            no info
            HGVS:
            AB093548.1:c.4349A>G, BAC21101.1:p.Gln1450Arg, NC_000002.11:g.166854675T>C, NC_000002.12:g.165998165T>C, NG_011906.1:g.80475A>G, NM_001165963.1:c.4349A>G, NM_001165964.1:c.4265A>G, NM_001202435.1:c.4349A>G, NM_006920.4:c.4316A>G, NP_001159435.1:p.Gln1450Arg, NP_001159436.1:p.Gln1422Arg, NP_001189364.1:p.Gln1450Arg, NP_008851.3:p.Gln1439Arg, NR_110598.1:n.176-17448T>C, XM_011511602.2:c.4349A>G, XM_011511604.2:c.4316A>G, XM_011511605.2:c.4313A>G, XM_011511606.2:c.4265A>G, XM_017004644.1:c.4349A>G, XM_017004645.1:c.4316A>G, XM_017004646.1:c.4316A>G, XM_017004647.1:c.4316A>G, XM_017004648.1:c.4316A>G, XM_017004649.1:c.4316A>G, XM_017004650.1:c.4313A>G, XM_017004651.1:c.4265A>G, XM_017004652.1:c.4265A>G, XM_017004653.1:c.4262A>G, XM_017004654.1:c.1907A>G, XP_011509904.1:p.Gln1450Arg, XP_011509906.1:p.Gln1439Arg, XP_011509907.1:p.Gln1438Arg, XP_011509908.1:p.Gln1422Arg, XP_016860133.1:p.Gln1450Arg, XP_016860134.1:p.Gln1439Arg, XP_016860135.1:p.Gln1439Arg, XP_016860136.1:p.Gln1439Arg, XP_016860137.1:p.Gln1439Arg, XP_016860138.1:p.Gln1439Arg, XP_016860139.1:p.Gln1438Arg, XP_016860140.1:p.Gln1422Arg, XP_016860141.1:p.Gln1422Arg, XP_016860142.1:p.Gln1421Arg, XP_016860143.1:p.Gln636Arg, XR_001738883.1:n.4799A>G, XR_001738884.1:n.4771A>G, XR_001738885.1:n.4763A>G
            6.

            rs121918789 [Homo sapiens]
              TTCTTAATAGGCCACATTCAAAGGA[C/T]GGATGGATATAATGTATGCAGCAGT
              Chromosome:
              2:165999761
              Gene:
              LOC102724058 (GeneView) SCN1A (GeneView)
              Functional Consequence:
              intron variant,missense,nc transcript variant
              Allele Origin:
              T(germline)/C(germline,unknown)
              Clinical significance:
              untested
              Validated:
              no info
              HGVS:
              AB093548.1:c.4300T>C, BAC21101.1:p.Trp1434Arg, NC_000002.11:g.166856271A>G, NC_000002.12:g.165999761A>G, NG_011906.1:g.78879T>C, NM_001165963.1:c.4300T>C, NM_001165964.1:c.4216T>C, NM_001202435.1:c.4300T>C, NM_006920.4:c.4267T>C, NP_001159435.1:p.Trp1434Arg, NP_001159436.1:p.Trp1406Arg, NP_001189364.1:p.Trp1434Arg, NP_008851.3:p.Trp1423Arg, NR_110598.1:n.176-15852A>G, XM_011511602.2:c.4300T>C, XM_011511604.2:c.4267T>C, XM_011511605.2:c.4264T>C, XM_011511606.2:c.4216T>C, XM_017004644.1:c.4300T>C, XM_017004645.1:c.4267T>C, XM_017004646.1:c.4267T>C, XM_017004647.1:c.4267T>C, XM_017004648.1:c.4267T>C, XM_017004649.1:c.4267T>C, XM_017004650.1:c.4264T>C, XM_017004651.1:c.4216T>C, XM_017004652.1:c.4216T>C, XM_017004653.1:c.4213T>C, XM_017004654.1:c.1858T>C, XP_011509904.1:p.Trp1434Arg, XP_011509906.1:p.Trp1423Arg, XP_011509907.1:p.Trp1422Arg, XP_011509908.1:p.Trp1406Arg, XP_016860133.1:p.Trp1434Arg, XP_016860134.1:p.Trp1423Arg, XP_016860135.1:p.Trp1423Arg, XP_016860136.1:p.Trp1423Arg, XP_016860137.1:p.Trp1423Arg, XP_016860138.1:p.Trp1423Arg, XP_016860139.1:p.Trp1422Arg, XP_016860140.1:p.Trp1406Arg, XP_016860141.1:p.Trp1406Arg, XP_016860142.1:p.Trp1405Arg, XP_016860143.1:p.Trp620Arg, XR_001738883.1:n.4750T>C, XR_001738884.1:n.4722T>C, XR_001738885.1:n.4714T>C
              7.

              rs121918788 [Homo sapiens]
                GATCGCCAGTGATTGTCAACTCCCA[C/T]GCTGGCACATGAATGACTTCTTCCA
                Chromosome:
                2:166037931
                Gene:
                SCN1A (GeneView)
                Functional Consequence:
                missense,nc transcript variant
                Allele Origin:
                T(germline)/C(germline)
                Clinical significance:
                Pathogenic
                Validated:
                no info
                HGVS:
                AB093548.1:c.2791C>T, BAC21101.1:p.Arg931Cys, NC_000002.11:g.166894441G>A, NC_000002.12:g.166037931G>A, NG_011906.1:g.40709C>T, NM_001165963.1:c.2791C>T, NM_001165964.1:c.2707C>T, NM_001202435.1:c.2791C>T, NM_006920.4:c.2758C>T, NP_001159435.1:p.Arg931Cys, NP_001159436.1:p.Arg903Cys, NP_001189364.1:p.Arg931Cys, NP_008851.3:p.Arg920Cys, XM_011511602.2:c.2791C>T, XM_011511604.2:c.2758C>T, XM_011511605.2:c.2755C>T, XM_011511606.2:c.2707C>T, XM_017004644.1:c.2791C>T, XM_017004645.1:c.2758C>T, XM_017004646.1:c.2758C>T, XM_017004647.1:c.2758C>T, XM_017004648.1:c.2758C>T, XM_017004649.1:c.2758C>T, XM_017004650.1:c.2755C>T, XM_017004651.1:c.2707C>T, XM_017004652.1:c.2707C>T, XM_017004653.1:c.2704C>T, XM_017004654.1:c.349C>T, XP_011509904.1:p.Arg931Cys, XP_011509906.1:p.Arg920Cys, XP_011509907.1:p.Arg919Cys, XP_011509908.1:p.Arg903Cys, XP_016860133.1:p.Arg931Cys, XP_016860134.1:p.Arg920Cys, XP_016860135.1:p.Arg920Cys, XP_016860136.1:p.Arg920Cys, XP_016860137.1:p.Arg920Cys, XP_016860138.1:p.Arg920Cys, XP_016860139.1:p.Arg919Cys, XP_016860140.1:p.Arg903Cys, XP_016860141.1:p.Arg903Cys, XP_016860142.1:p.Arg902Cys, XP_016860143.1:p.Arg117Cys, XR_001738883.1:n.3177C>T, XR_001738884.1:n.3149C>T, XR_001738885.1:n.3141C>T
                8.

                rs121918787 [Homo sapiens]
                  ACCCTCGTCTTGGCCATCATCGTCT[G/T]CATTTTTGCCGTGGTCGGCATGCAG
                  Chromosome:
                  2:166038017
                  Gene:
                  SCN1A (GeneView)
                  Functional Consequence:
                  missense,nc transcript variant
                  Allele Origin:
                  G(unknown)/T(germline,unknown)
                  Clinical significance:
                  untested
                  Validated:
                  no info
                  HGVS:
                  AB093548.1:c.2705T>G, BAC21101.1:p.Phe902Cys, NC_000002.11:g.166894527A>C, NC_000002.12:g.166038017A>C, NG_011906.1:g.40623T>G, NM_001165963.1:c.2705T>G, NM_001165964.1:c.2621T>G, NM_001202435.1:c.2705T>G, NM_006920.4:c.2672T>G, NP_001159435.1:p.Phe902Cys, NP_001159436.1:p.Phe874Cys, NP_001189364.1:p.Phe902Cys, NP_008851.3:p.Phe891Cys, XM_011511602.2:c.2705T>G, XM_011511604.2:c.2672T>G, XM_011511605.2:c.2669T>G, XM_011511606.2:c.2621T>G, XM_017004644.1:c.2705T>G, XM_017004645.1:c.2672T>G, XM_017004646.1:c.2672T>G, XM_017004647.1:c.2672T>G, XM_017004648.1:c.2672T>G, XM_017004649.1:c.2672T>G, XM_017004650.1:c.2669T>G, XM_017004651.1:c.2621T>G, XM_017004652.1:c.2621T>G, XM_017004653.1:c.2618T>G, XM_017004654.1:c.263T>G, XP_011509904.1:p.Phe902Cys, XP_011509906.1:p.Phe891Cys, XP_011509907.1:p.Phe890Cys, XP_011509908.1:p.Phe874Cys, XP_016860133.1:p.Phe902Cys, XP_016860134.1:p.Phe891Cys, XP_016860135.1:p.Phe891Cys, XP_016860136.1:p.Phe891Cys, XP_016860137.1:p.Phe891Cys, XP_016860138.1:p.Phe891Cys, XP_016860139.1:p.Phe890Cys, XP_016860140.1:p.Phe874Cys, XP_016860141.1:p.Phe874Cys, XP_016860142.1:p.Phe873Cys, XP_016860143.1:p.Phe88Cys, XR_001738883.1:n.3091T>G, XR_001738884.1:n.3063T>G, XR_001738885.1:n.3055T>G
                  9.

                  rs121917986 [Homo sapiens]
                    TGGTGACAGGTTTGACATCGAAGAC[A/C/G]TGAATAATCATACTGATTGCCTAAA
                    Chromosome:
                    2:166002588
                    Gene:
                    LOC102724058 (GeneView) SCN1A (GeneView)
                    Functional Consequence:
                    intron variant,missense,nc transcript variant
                    Allele Origin:
                    G(germline)/A(de-novo,germline)/C(de-novo,germline)
                    Clinical significance:
                    Pathogenic
                    Validated:
                    by cluster
                    HGVS:
                    AB093548.1:c.4168G>A, AB093548.1:c.4168G>C, BAC21101.1:p.Val1390Leu, BAC21101.1:p.Val1390Met, NC_000002.11:g.166859098C>G, NC_000002.11:g.166859098C>T, NC_000002.12:g.166002588C>G, NC_000002.12:g.166002588C>T, NG_011906.1:g.76052G>A, NG_011906.1:g.76052G>C, NM_001165963.1:c.4168G>A, NM_001165963.1:c.4168G>C, NM_001165964.1:c.4084G>A, NM_001165964.1:c.4084G>C, NM_001202435.1:c.4168G>A, NM_001202435.1:c.4168G>C, NM_006920.4:c.4135G>A, NM_006920.4:c.4135G>C, NP_001159435.1:p.Val1390Leu, NP_001159435.1:p.Val1390Met, NP_001159436.1:p.Val1362Leu, NP_001159436.1:p.Val1362Met, NP_001189364.1:p.Val1390Leu, NP_001189364.1:p.Val1390Met, NP_008851.3:p.Val1379Leu, NP_008851.3:p.Val1379Met, NR_110598.1:n.176-13025C>G, NR_110598.1:n.176-13025C>T, XM_011511602.2:c.4168G>A, XM_011511602.2:c.4168G>C, XM_011511604.2:c.4135G>A, XM_011511604.2:c.4135G>C, XM_011511605.2:c.4132G>A, XM_011511605.2:c.4132G>C, XM_011511606.2:c.4084G>A, XM_011511606.2:c.4084G>C, XM_017004644.1:c.4168G>A, XM_017004644.1:c.4168G>C, XM_017004645.1:c.4135G>A, XM_017004645.1:c.4135G>C, XM_017004646.1:c.4135G>A, XM_017004646.1:c.4135G>C, XM_017004647.1:c.4135G>A, XM_017004647.1:c.4135G>C, XM_017004648.1:c.4135G>A, XM_017004648.1:c.4135G>C, XM_017004649.1:c.4135G>A, XM_017004649.1:c.4135G>C, XM_017004650.1:c.4132G>A, XM_017004650.1:c.4132G>C, XM_017004651.1:c.4084G>A, XM_017004651.1:c.4084G>C, XM_017004652.1:c.4084G>A, XM_017004652.1:c.4084G>C, XM_017004653.1:c.4081G>A, XM_017004653.1:c.4081G>C, XM_017004654.1:c.1726G>A, XM_017004654.1:c.1726G>C, XP_011509904.1:p.Val1390Leu, XP_011509904.1:p.Val1390Met, XP_011509906.1:p.Val1379Leu, XP_011509906.1:p.Val1379Met, XP_011509907.1:p.Val1378Leu, XP_011509907.1:p.Val1378Met, XP_011509908.1:p.Val1362Leu, XP_011509908.1:p.Val1362Met, XP_016860133.1:p.Val1390Leu, XP_016860133.1:p.Val1390Met, XP_016860134.1:p.Val1379Leu, XP_016860134.1:p.Val1379Met, XP_016860135.1:p.Val1379Leu, XP_016860135.1:p.Val1379Met, XP_016860136.1:p.Val1379Leu, XP_016860136.1:p.Val1379Met, XP_016860137.1:p.Val1379Leu, XP_016860137.1:p.Val1379Met, XP_016860138.1:p.Val1379Leu, XP_016860138.1:p.Val1379Met, XP_016860139.1:p.Val1378Leu, XP_016860139.1:p.Val1378Met, XP_016860140.1:p.Val1362Leu, XP_016860140.1:p.Val1362Met, XP_016860141.1:p.Val1362Leu, XP_016860141.1:p.Val1362Met, XP_016860142.1:p.Val1361Leu, XP_016860142.1:p.Val1361Met, XP_016860143.1:p.Val576Leu, XP_016860143.1:p.Val576Met, XR_001738883.1:n.4618G>A, XR_001738883.1:n.4618G>C, XR_001738884.1:n.4590G>A, XR_001738884.1:n.4590G>C, XR_001738885.1:n.4582G>A, XR_001738885.1:n.4582G>C

                    Display Settings:

                    Format
                    Items per page
                    Sort by

                    Send to:

                    Choose Destination

                    Supplemental Content

                    Find related data

                    Recent activity

                    Your browsing activity is empty.

                    Activity recording is turned off.

                    Turn recording back on

                    See more...
                    Support Center