Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

2.

rs111033258 [Homo sapiens]
    GCAAAACGGGAGCTCTGCTCGTCAA[G/T]GCCTCAGGGCAGGAGCTGGACAAGT
    Chromosome:
    3:150972565
    Gene:
    CLRN1-AS1 (GeneView) CLRN1 (GeneView)
    Functional Consequence:
    missense,nc transcript variant,upstream variant 2KB
    Allele Origin:
    G(germline)/T(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000003.11:g.150690352A>C, NC_000003.12:g.150972565A>C, NG_009168.1:g.5435T>G, NM_001195794.1:c.144T>G, NM_001256819.1:c.144T>G, NM_174878.2:c.144T>G, NP_001182723.1:p.Asn48Lys, NP_001243748.1:p.Asn48Lys, NP_777367.1:p.Asn48Lys, NR_024066.1:n.-113A>C, NR_024066.2:n.-113A>C, NR_046380.2:n.435T>G
    3.

    rs3796242 [Homo sapiens]
      GCATGGCCGGAGTGTTCAGTTTTGC[A/T]TGTGCCCTCGGAGTTGTGACAGCCT
      Chromosome:
      3:150972652
      Gene:
      CLRN1-AS1 (GeneView) CLRN1 (GeneView)
      Functional Consequence:
      nc transcript variant,synonymous codon,upstream variant 2KB
      Allele Origin:
      T(germline)/A(germline)
      Clinical significance:
      Benign
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1336/669
      HGVS:
      NC_000003.11:g.150690439T>A, NC_000003.12:g.150972652T>A, NG_009168.1:g.5348A>T, NM_001195794.1:c.57A>T, NM_001256819.1:c.57A>T, NM_174878.2:c.57A>T, NP_001182723.1:p.Ala19, NP_001243748.1:p.Ala19, NP_777367.1:p.Ala19, NR_024066.1:n.-26T>A, NR_024066.2:n.-26T>A, NR_046380.2:n.348A>T

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center