Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 9

1.

rs2020941 [Homo sapiens]
    GGCGACACCAACCACCCCAGCATCA[A/G]TAACCTGCACACTCTTCTCCCTAGG
    Chromosome:
    17:30222940
    Gene:
    SLC6A4 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.0074/37
    HGVS:
    NC_000017.10:g.28549958C>T, NC_000017.11:g.30222940C>T, NG_011747.2:g.17997G>A, NM_001045.5:c.-220-25G>A, XM_005258025.1:c.-94-25G>A
    2.

    rs2020940 [Homo sapiens]
      CCCAGTGGAGGCACAGGGGGACGGC[A/C/G]AAACCAACCACCCCAGCATCAGTAA
      Chromosome:
      17:30222962
      Gene:
      SLC6A4 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      G=0.0176/88
      HGVS:
      NC_000017.10:g.28549980C>G, NC_000017.11:g.30222962C>G, NG_011747.2:g.17975G>C, NM_001045.5:c.-220-47G>C, XM_005258025.1:c.-94-47G>C
      3.

      rs2020932 [Homo sapiens]
        CAACCACGCCCGGCTAATTAAAAAA[A/T]TTTTTTTTCTAGAGATGGGGTCTTG
        Chromosome:
        17:30236481
        Gene:
        LOC105371720 (GeneView) SLC6A4 (GeneView)
        Functional Consequence:
        upstream variant 2KB
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency
        Global MAF:
        A=0.1478/740
        HGVS:
        NC_000017.10:g.28563499T>A, NC_000017.11:g.30236481T>A, NG_011747.2:g.4456A>T, NM_001045.5:c.-1089A>T, XM_005258025.1:c.-963A>T, XR_934652.1:n.-1072T>A, XR_934653.1:n.-1072T>A, XR_934654.1:n.-425T>A, XR_934655.1:n.-1072T>A
        4.

        rs140702 [Homo sapiens]
          ATATATGTATGTACCTGTGCCATGG[C/T]GAAGACCTCTAATGGCTGTCACTGT
          Chromosome:
          17:30203030
          Gene:
          SLC6A4 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by cluster,by hapmap
          HGVS:
          NC_000017.10:g.28530048G>A, NC_000017.11:g.30203030G>A, NG_011747.2:g.37907C>T, NM_001045.5:c.1818+142C>T, XM_005258025.1:c.1944+142C>T
          5.

          rs140699 [Homo sapiens]
            TGAAGAATTTTACACGTAAGTGCAC[A/G/T]TAAGTGAGGGGTTGGCCTGTTAGGG
            Chromosome:
            17:30218107
            Gene:
            SLC6A4 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            T=0.0008/4
            HGVS:
            NC_000017.10:g.28545125C>A, NC_000017.10:g.28545125C>T, NC_000017.11:g.30218107C>A, NC_000017.11:g.30218107C>T, NG_011747.2:g.22830G>A, NG_011747.2:g.22830G>T, NM_001045.5:c.698+11G>A, NM_001045.5:c.698+11G>T, XM_005258025.1:c.824+11G>A, XM_005258025.1:c.824+11G>T
            6.

            rs25533 [Homo sapiens]
              CCCGCCCCGTAGCGCGGCCCCTCCC[C/T]GGCGAGCGCAACCCCATCCAGCGGG
              Chromosome:
              17:30235874
              Gene:
              LOC105371720 (GeneView) SLC6A4 (GeneView)
              Functional Consequence:
              upstream variant 2KB,utr variant 5 prime
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              G=0.0729/365
              HGVS:
              NC_000017.10:g.28562892A>G, NC_000017.11:g.30235874A>G, NG_011747.2:g.5063T>C, NM_001045.5:c.-482T>C, XM_005258025.1:c.-356T>C, XR_934652.1:n.-1679A>G, XR_934653.1:n.-1679A>G, XR_934654.1:n.-1032A>G, XR_934655.1:n.-1679A>G
              7.

              rs25532 [Homo sapiens]
                CCAGCATCCCCCCATGCACCCCCGG[C/T]ATCCCCCCTGCACCCCTCCAGCATT
                Chromosome:
                17:30237152
                Gene:
                LOC105371720 (GeneView) SLC6A4 (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Validated:
                by 1000G,by cluster,by frequency
                HGVS:
                NC_000017.10:g.28564170G>A, NC_000017.11:g.30237152G>A, NG_011747.2:g.3785C>T, NM_001045.5:c.-1760C>T, XM_005258025.1:c.-1634C>T, XR_934652.1:n.-401G>A, XR_934653.1:n.-401G>A, XR_934654.1:n.165+82G>A, XR_934655.1:n.-401G>A
                8.

                rs25531 [Homo sapiens]
                  CTCGCGGCATCCCCCCTGCACCCCC[A/G]GCATCCCCCCTGCAGCCCCCCCAGC
                  Chromosome:
                  17:30237328
                  Gene:
                  LOC105371720 (GeneView) SLC6A4 (GeneView)
                  Functional Consequence:
                  intron variant,upstream variant 2KB
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  C=0.1376/689
                  HGVS:
                  NC_000017.10:g.28564346T>C, NC_000017.11:g.30237328T>C, NG_011747.2:g.3609A>G, NM_001045.5:c.-1936A>G, XM_005258025.1:c.-1810A>G, XR_934652.1:n.-225T>C, XR_934653.1:n.-225T>C, XR_934654.1:n.165+258T>C, XR_934655.1:n.-225T>C
                  9.

                  Error occurred: cannot get document summary

                  Display Settings:

                  Format
                  Items per page
                  Sort by

                  Send to:

                  Choose Destination

                  Supplemental Content

                  Find related data

                  Recent activity

                  Your browsing activity is empty.

                  Activity recording is turned off.

                  Turn recording back on

                  See more...
                  Support Center