Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 11446

1.

Error occurred: cannot get document summary

2.

Error occurred: cannot get document summary

3.

Error occurred: cannot get document summary

4.

rs36126436 [Homo sapiens]
    CCTTTATATTAAAAAATCAGTTGAG[C/T]CCACCTATCCTATAAGCAAACGTAT
    Chromosome:
    9:130715341
    Gene:
    ABL1 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.0054/27
    HGVS:
    CM000671.2:g.130715341C>T, NC_000009.11:g.133590728C>T, NC_000009.12:g.130715341C>T, NG_012034.1:g.6461C>T, NG_050744.1:g.5313C>T, NM_007313.2:c.136+886C>T
    7.

    rs36121913 [Homo sapiens]
      TTCCTGTTTCTTTCTAACCCAGGCT[A/G]GGCAGATGCCTTGAATCACAGCAGT
      Chromosome:
      X:140662595
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      G=0.0413/156
      HGVS:
      CM000685.2:g.140662595A>G, NC_000023.10:g.139744760A>G
      8.

      rs36119733 [Homo sapiens]
        AACTTTTTTACAGTCTTTTCAGATC[A/G]TCAAGCTGAATAATGAATCTGAAGT
        Chromosome:
        10:106531759
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        G=0.0126/63
        HGVS:
        CM000672.2:g.106531759A>G, NC_000010.10:g.108291517A>G
        9.

        rs36117728 [Homo sapiens]
          TAAGAAGATACATTCAAGTGTTGGC[A/G]GTTGATTCTGTGGATTAATAGCAGC
          Chromosome:
          11:97816793
          Validated:
          by 1000G,by frequency
          Global MAF:
          A=0.0012/6
          HGVS:
          CM000673.2:g.97816793G>A, NC_000011.9:g.97687793G>A, NC_000011.9:g.97687793G>T
          10.

          rs36116712 [Homo sapiens]
            TTTTTGTGGGATAAAAGCTCTCCCA[C/G]ACACCCATGTTATGACTTCTTCTTG
            Chromosome:
            18:1268892
            Gene:
            LINC00470 (GeneView)
            Functional Consequence:
            nc transcript variant
            Validated:
            no info
            HGVS:
            CM000680.2:g.1268892G>C, NC_000018.10:g.1268892G>C, NC_000018.9:g.1268893G>C, NR_023925.1:n.1650C>G, NR_023926.1:n.1604C>G, NR_023927.1:n.1309C>G, NR_110327.1:n.1421C>G
            11.

            rs36116074 [Homo sapiens]
              CACAGATTATAGGGTGATAGGAAAA[A/G]GAAGGCAACATTCATCAAATGCCTC
              Chromosome:
              X:129135789
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              G=0.2379/898
              HGVS:
              CM000685.2:g.129135789A>G, NC_000023.10:g.128269766A>G
              12.

              rs36115999 [Homo sapiens]
                GCCTCTTAGTTCTAGTTGATTAAAG[C/T]ATGTTGTTATTGTTGCTCATTTTAT
                Chromosome:
                15:58033376
                Gene:
                ALDH1A2 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency
                Global MAF:
                C=0.0022/11
                HGVS:
                CM000677.2:g.58033376T>C, NC_000015.10:g.58033376T>C, NC_000015.9:g.58325574T>C, NG_012259.1:g.37333A>G, NM_001206897.1:c.55-19095A>G, NM_003888.3:c.118-19095A>G, NM_170696.2:c.118-19095A>G
                13.

                rs36110558 [Homo sapiens]
                  CACAAAATGAAATAAGCTATCACTT[C/T]ACACCCACATGACTGAATGAAACAC
                  Chromosome:
                  15:34572113
                  Gene:
                  GOLGA8B (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G,by cluster,by frequency
                  Global MAF:
                  T=0.3564/1785
                  HGVS:
                  CM000677.2:g.34572113C>T, NC_000015.10:g.34572113C>T, NC_000015.9:g.34864314C>T, NR_027410.1:n.144+9353G>A
                  14.

                  rs36106944 [Homo sapiens]
                    AGCCCCAATTTATAAGTTTCTACAT[C/T]ATCACCATTAGAAGCCCACAGCAAG
                    Chromosome:
                    X:110270720
                    Gene:
                    AMMECR1 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency
                    Global MAF:
                    C=0.0122/46
                    HGVS:
                    CM000685.2:g.110270720T>C, NC_000023.10:g.109513948T>C, NC_000023.11:g.110270720T>C, NG_016469.1:g.174514A>G, NM_001025580.1:c.473+46879A>G, NM_001171689.1:c.105-6121A>G, NM_015365.2:c.474-6121A>G
                    15.

                    rs36105925 [Homo sapiens]
                      TTTTTCAGAGGTTTGGGTAATTTAA[A/G]CGTCCCTTCTTTAATGGAATGATGG
                      Chromosome:
                      3:72452368
                      Validated:
                      by 1000G,by cluster,by frequency
                      Global MAF:
                      A=0.0006/3
                      HGVS:
                      CM000665.2:g.72452368G>A, NC_000003.11:g.72501519G>A, NW_011332691.1:g.127299G>A
                      16.

                      rs36101632 [Homo sapiens]
                        ATCATTTGATTAATGGAGTCACTTT[C/T]AGTTTGCAACAATCATGTCAGTGCA
                        Chromosome:
                        3:153187961
                        Gene:
                        LOC105374164 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster,by frequency
                        Global MAF:
                        C=0.0238/119
                        HGVS:
                        CM000665.2:g.153187961T>C, NC_000003.11:g.152905750T>C, NC_000003.12:g.153187961T>C, XR_001740973.1:n.102+7270T>C, XR_001740974.1:n.41+9172T>C, XR_924592.2:n.102+7270T>C
                        17.

                        rs36095985 [Homo sapiens]
                          CAATTACATCTGACCTTGTCAATCT[G/T]GAGCAGCTCAACAAATCTCATGCCA
                          Chromosome:
                          X:8021305
                          Gene:
                          LOC107985675 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency
                          Global MAF:
                          G=0.1754/662
                          HGVS:
                          CM000685.2:g.8021305T>G, NC_000023.10:g.7989346T>G, NC_000023.11:g.8021305T>G, XR_001755782.1:n.1406+91892T>G, XR_001755783.1:n.1406+91892T>G, XR_001755784.1:n.1406+91892T>G, XR_001755785.1:n.1406+91892T>G, XR_001755786.1:n.1406+91892T>G, XR_001755787.1:n.1406+91892T>G, XR_001755788.1:n.1406+91892T>G, XR_001755789.1:n.1406+91892T>G
                          18.

                          rs36095597 [Homo sapiens]
                            GTATTCCTTAACTACAATTTCAAAA[C/T]GTTTTTCCCTACAGGCCAACAACCC
                            Chromosome:
                            12:45722540
                            Validated:
                            by 1000G,by cluster,by frequency
                            Global MAF:
                            C=0.0112/56
                            HGVS:
                            CM000674.2:g.45722540T>C, NC_000012.11:g.46116323T>C
                            19.

                            rs36094783 [Homo sapiens]
                              ACTTGCCACTTTCTCCCAGGCTGGA[A/G]TTTTTTTATTGAAGTGCTAACAAAT
                              Chromosome:
                              20:31346411
                              Validated:
                              by 1000G,by cluster,by frequency
                              Global MAF:
                              A=0.0152/76
                              HGVS:
                              CM000682.2:g.31346411G>A, NC_000020.10:g.29934214G>A
                              20.

                              rs36090553 [Homo sapiens]
                                CTAAAATATCAGTGTAGTCATGTCA[A/C/G]ATCTTTCGTTTCATTGTCTCCAGAG
                                Chromosome:
                                4:1123731
                                Gene:
                                LOC105374344 (GeneView) TMED11P (GeneView)
                                Functional Consequence:
                                intron variant,upstream variant 2KB
                                Validated:
                                by 1000G,by cluster,by frequency
                                Global MAF:
                                G=0.0086/43
                                HGVS:
                                CM000666.2:g.1123731A>C, CM000666.2:g.1123731A>G, NC_000004.11:g.1117519A>G, NC_000004.12:g.1123731A>C, NC_000004.12:g.1123731A>G, NR_033768.1:n.-567T>C, NR_033768.1:n.-567T>G, NR_134676.1:n.115-8598A>C, NR_134676.1:n.115-8598A>G

                                Display Settings:

                                Format
                                Items per page
                                Sort by

                                Send to:

                                Choose Destination

                                Supplemental Content

                                Find related data

                                Recent activity

                                Your browsing activity is empty.

                                Activity recording is turned off.

                                Turn recording back on

                                See more...
                                Support Center