Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 884173

1.

rs5741505 [Anopheles gambiae]
    GTGCAAAACCGAAACCGATAACTCG[A/G]GCTGCAAATTTCTAATACCACACAA
    Chromosome:
    3R:7089263
    Validated:
    no info
    2.

    rs5741504 [Anopheles gambiae]
      GCTATTAGCATGGGGTGAATATTCC[G/T]TTGATATGAACTCGTTATAATCTCA
      Chromosome:
      2L:15200677
      Validated:
      no info
      3.

      rs5741503 [Anopheles gambiae]
        TTACTGTTTGTCCAAAAGTGTGTCT[C/T]AATTCAGCGAGGCTGATTTGAAAAA
        Chromosome:
        2R:54865903
        Validated:
        no info
        4.

        rs5741502 [Anopheles gambiae]
          CGAATAATGCGTTCCGGAAACATTC[G/T]TGTAACTCGAATTTTCGCATAAGTC
          Chromosome:
          2L:8378726
          Validated:
          no info
          5.

          rs5741501 [Anopheles gambiae]
            CCGGTGCGTTTGCTGCGTTCGATTT[C/T]CTTCTCTGCACGGTTTGCGTGTTCT
            Chromosome:
            2L:34405210
            Validated:
            no info
            6.

            rs5741500 [Anopheles gambiae]
              CGCAACAAAGAGCCAGCTACTGCTT[C/T]TTCTTCCCTCACTTCTTTCTTCGGC
              Chromosome:
              3L:20840707
              Validated:
              no info
              7.

              rs5741499 [Anopheles gambiae]
                ACTGGTGTTCGTATCTTAATCCTCT[C/T]CGCAACAAAAAAGAAAGGTCACACA
                Chromosome:
                2R:2792525
                Validated:
                no info
                8.

                rs5741498 [Anopheles gambiae]
                  GCTTCTTCTGCTCTAACACTAATCC[C/T]CGACACAAAACCGTACACGCCTCCC
                  Chromosome:
                  2L:22106480
                  Validated:
                  no info
                  9.

                  rs5741497 [Anopheles gambiae]
                    TGATGCAATAACGATAGTGATTTTT[C/T]TCTATTTATAGTCAACCAAAAAATT
                    Chromosome:
                    2L:35132529
                    Validated:
                    no info
                    10.

                    rs5741496 [Anopheles gambiae]
                      GCTGCTACGGCCGTCGAAAAGTGCG[A/G]CAGAAACGATCGAGCTTGCGCTGGA
                      Chromosome:
                      3R:10243730
                      Gene:
                      AgaP_AGAP008388 (GeneView)
                      Functional Consequence:
                      missense
                      Validated:
                      no info
                      11.

                      rs5741495 [Anopheles gambiae]
                        ATGCACAGCAGACAGGATTAAAGCG[C/T]TCACCCCTGAGGGGCAACATATTCA
                        Chromosome:
                        2R:2446600
                        Validated:
                        no info
                        12.

                        rs5741494 [Anopheles gambiae]
                          CTGAAGCTGAAGGCTCTTGGGTACG[A/G]GTCTTTGTTTTCCATTCCTACACAC
                          Validated:
                          no info
                          13.

                          rs5741493 [Anopheles gambiae]
                            GGAGAGAGGCGACTGGAATGCACTT[A/T]CAGCTAATAGTTTCCCGCTTGGGGG
                            Chromosome:
                            3R:39550254
                            Validated:
                            no info
                            14.

                            rs5741492 [Anopheles gambiae]
                              CTCCACCACCCCCGCCGCCCGCCTT[A/G]TGATGCATCTTGCCGAGCCCCCGGT
                              Chromosome:
                              X:5901856
                              Gene:
                              AgaP_AGAP000342 (GeneView)
                              Functional Consequence:
                              synonymous codon
                              Validated:
                              no info
                              15.

                              rs5741491 [Anopheles gambiae]
                                AAATCACAAACACCACTCACAGGCC[C/G]CGGGTCGCTGTCGTCATGTGTGTGT
                                Chromosome:
                                3L:27560649
                                Validated:
                                no info
                                16.

                                rs5741490 [Anopheles gambiae]
                                  TTGAATGGGAATCAATCCCATCTAA[C/T]TTTAAAGGAGTCCGCTGGCCAGTGT
                                  Chromosome:
                                  3R:38135583
                                  Gene:
                                  SRPN4 (GeneView)
                                  Functional Consequence:
                                  upstream variant 2KB
                                  Validated:
                                  no info
                                  17.

                                  rs5741489 [Anopheles gambiae]
                                    CAAATAAACAAAATAATTCATGAAA[A/G]ACTAAGCCTAACTAACCTAGTCTTG
                                    Validated:
                                    no info
                                    18.

                                    rs5741488 [Anopheles gambiae]
                                      AAATAAATTATAATCCCATTGGTCT[A/G]TTACATAGAACTACTAGTAAAACTA
                                      Chromosome:
                                      2L:10166648
                                      Validated:
                                      no info
                                      19.

                                      rs5741487 [Anopheles gambiae]
                                        TTTAAGCACAATACCTGCAGAATTG[C/T]AAAATACGCAGTGCTTGTGGTATTC
                                        Validated:
                                        no info
                                        20.

                                        rs5741486 [Anopheles gambiae]
                                          ATTGTTTTATTACATCTTTCTTCCA[C/T]ATTTGGAAAGTAAATGTATTTGGTT
                                          Chromosome:
                                          2R:50644251
                                          Validated:
                                          no info

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center