Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs80356655 [Homo sapiens]
    GTCCCCCCGACCTCCACCCCAGGCA[C/T]GGGCTGCAATGCCTGCTACATGGAG
    Chromosome:
    7:44147830
    Gene:
    GCK (GeneView) LOC105375258 (GeneView)
    Functional Consequence:
    intron variant,missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000007.13:g.44187429G>A, NC_000007.14:g.44147830G>A, NG_008847.2:g.55341C>T, NM_000162.3:c.683C>T, NM_033507.1:c.686C>T, NM_033508.1:c.680C>T, NP_000153.1:p.Thr228Met, NP_277042.1:p.Thr229Met, NP_277043.1:p.Thr227Met, XM_017011966.1:c.683C>T, XP_016867455.1:p.Thr228Met, XR_927223.2:n.82+82G>A
    2.

    rs80356654 [Homo sapiens]
      ATGGTGAATGACACGGTGGCCACGA[A/T]GATCTCCTGCTACTACGAAGACCAT
      Chromosome:
      7:44149810
      Gene:
      GCK (GeneView) LOC105375258 (GeneView)
      Functional Consequence:
      downstream variant 500B,missense
      Allele Origin:
      T(germline)/A(germline)
      Clinical significance:
      Pathogenic
      Validated:
      by cluster
      HGVS:
      NC_000007.13:g.44189409A>T, NC_000007.14:g.44149810A>T, NG_008847.2:g.53361T>A, NM_000162.3:c.629T>A, NM_033507.1:c.632T>A, NM_033508.1:c.626T>A, NP_000153.1:p.Met210Lys, NP_277042.1:p.Met211Lys, NP_277043.1:p.Met209Lys, XM_017011966.1:c.629T>A, XP_016867455.1:p.Met210Lys, XR_927223.2:n.325A>T

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center