Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 12

2.

rs111033308 [Homo sapiens]
    GTCCATCATTCTGGGGCTGGATCTC[A/G]GTTTACTAGCTGGCCTTATATTTGG
    Chromosome:
    7:107695984
    Gene:
    SLC26A4 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster,by frequency
    HGVS:
    CM000669.2:g.107695984G>A, NC_000007.13:g.107336429G>A, NC_000007.14:g.107695984G>A, NG_008489.1:g.40350G>A, NM_000441.1:c.1489G>A, NP_000432.1:p.Gly497Ser, XP_005250482.1:p.Gly497Ser, XP_005250483.1:p.Gly84Ser, XP_005250484.1:p.Gly66Ser, XP_005250485.1:p.Gly58Ser, XP_016867807.1:p.Gly471Ser
    3.

    rs111033303 [Homo sapiens]
      TTGATATTTGGTGGCTTGCAGATTG[G/T]ATTCATAGTGAGGTACTTGGCAGAT
      Chromosome:
      7:107674970
      Gene:
      SLC26A4 (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      G(germline)/T(germline)
      Clinical significance:
      Pathogenic
      Validated:
      by cluster,by frequency
      HGVS:
      CM000669.2:g.107674970G>T, NC_000007.13:g.107315415G>T, NC_000007.14:g.107674970G>T, NG_008489.1:g.19336G>T, NM_000441.1:c.626G>T, NP_000432.1:p.Gly209Val, XP_005250482.1:p.Gly209Val, XP_006716088.1:p.Gly209Val, XP_016867807.1:p.Gly209Val
      4.

      rs111033254 [Homo sapiens]
        TGGAAGCATCCCTAGCACAGATATC[C/T]ACAAAAGTACCAAGAATTACAAAAA
        Chromosome:
        7:107698085
        Gene:
        SLC26A4 (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        T(germline)/C(germline)
        Clinical significance:
        Pathogenic
        Validated:
        by cluster
        HGVS:
        CM000669.2:g.107698085T>C, NC_000007.13:g.107338530T>C, NC_000007.14:g.107698085T>C, NG_008489.1:g.42451T>C, NM_000441.1:c.1588T>C, NP_000432.1:p.Tyr530His, XP_005250482.1:p.Tyr530His, XP_005250483.1:p.Tyr117His, XP_005250484.1:p.Tyr99His, XP_005250485.1:p.Tyr91His, XP_016867807.1:p.Tyr504His
        9.

        rs80338849 [Homo sapiens]
          GCATTGTTAAATCCATCCCAAGGGG[A/G/T]TGAGTGTGGTGTTCCTCTTAGTACT
          Chromosome:
          7:107683538
          Gene:
          SLC26A4 (GeneView)
          Functional Consequence:
          splice donor variant
          Allele Origin:
          G(germline)/A(germline)
          Clinical significance:
          Pathogenic
          Validated:
          by cluster,by frequency
          HGVS:
          CM000669.2:g.107683538G>A, CM000669.2:g.107683538G>T, NC_000007.13:g.107323983G>A, NC_000007.14:g.107683538G>A, NC_000007.14:g.107683538G>T, NG_008489.1:g.27904G>A, NG_008489.1:g.27904G>T, NM_000441.1:c.1001+1G>A, NM_000441.1:c.1001+1G>T
          10.

          rs80338848 [Homo sapiens]
            GCCTTCCAAGTGCTGGTCTCACAGC[C/T]AAAGATTGTCCTCAATGTTTCAACC
            Chromosome:
            7:107675051
            Gene:
            SLC26A4 (GeneView)
            Functional Consequence:
            missense
            Allele Origin:
            T(germline)/C(germline)
            Clinical significance:
            Pathogenic
            Validated:
            by cluster,by frequency
            HGVS:
            CM000669.2:g.107675051T>C, NC_000007.13:g.107315496T>C, NC_000007.14:g.107675051T>C, NG_008489.1:g.19417T>C, NM_000441.1:c.707T>C, NP_000432.1:p.Leu236Pro, XP_005250482.1:p.Leu236Pro, XP_006716088.1:p.Leu236Pro, XP_016867807.1:p.Leu236Pro
            11.

            rs55638457 [Homo sapiens]
              CAGAAACTAATAAAAAGTGGACAAT[C/T]AAGAGCAACAAAGGTGAGATGACAT
              Chromosome:
              7:107701183
              Gene:
              SLC26A4 (GeneView)
              Functional Consequence:
              missense
              Allele Origin:
              T(germline)/C(germline)
              Clinical significance:
              Likely benign
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              C=0.0086/43
              HGVS:
              CM000669.2:g.107701183T>C, NC_000007.13:g.107341628T>C, NC_000007.14:g.107701183T>C, NG_008489.1:g.45549T>C, NM_000441.1:c.1790T>C, NP_000432.1:p.Leu597Ser, XP_005250482.1:p.Leu597Ser, XP_005250483.1:p.Leu184Ser, XP_005250484.1:p.Leu166Ser, XP_005250485.1:p.Leu158Ser, XP_016867807.1:p.Leu571Ser

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center