Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs104894504 [Homo sapiens]
    TCTCTGAACAGACGCATCCAGCTGG[C/T]TGAGGAAGAGTTGGATCGTGCCCAG
    Chromosome:
    15:63057028
    Gene:
    TPM1 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000015.10:g.63057028T>C, NC_000015.9:g.63349227T>C, NG_007557.1:g.19390T>C, NM_000366.5:c.284T>C, NM_001018004.1:c.284T>C, NM_001018005.1:c.284T>C, NM_001018006.1:c.284T>C, NM_001018007.1:c.284T>C, NM_001018008.1:c.176T>C, NM_001018020.1:c.284T>C, NM_001301244.1:c.284T>C, NM_001301289.1:c.176T>C, NM_001330344.1:c.176T>C, NM_001330346.1:c.176T>C, NM_001330351.1:c.176T>C, NP_000357.3:p.Val95Ala, NP_001018004.1:p.Val95Ala, NP_001018005.1:p.Val95Ala, NP_001018006.1:p.Val95Ala, NP_001018007.1:p.Val95Ala, NP_001018008.1:p.Val59Ala, NP_001018020.1:p.Val95Ala, NP_001288173.1:p.Val95Ala, NP_001288218.1:p.Val59Ala, NP_001317273.1:p.Val59Ala, NP_001317275.1:p.Val59Ala, NP_001317280.1:p.Val59Ala, XM_005254636.1:c.410T>C, XM_005254637.1:c.410T>C, XM_005254638.1:c.284T>C, XM_005254638.3:c.536T>C, XM_005254639.1:c.284T>C, XM_005254639.3:c.536T>C, XM_005254640.1:c.284T>C, XM_005254641.1:c.284T>C, XM_005254642.1:c.284T>C, XM_005254643.1:c.284T>C, XM_005254644.1:c.284T>C, XM_005254645.1:c.284T>C, XM_005254645.2:c.536T>C, XM_005254646.1:c.176T>C, XM_005254646.2:c.176T>C, XM_005254647.1:c.176T>C, XM_005254647.3:c.176T>C, XM_005254648.1:c.176T>C, XM_005254649.1:c.176T>C, XM_005254650.1:c.176T>C, XM_005254650.3:c.176T>C, XM_005254651.1:c.176T>C, XM_005254652.1:c.176T>C, XM_005254653.1:c.176T>C, XM_005254653.2:c.176T>C, XM_006720667.3:c.536T>C, XM_017022534.1:c.536T>C, XM_017022535.1:c.284T>C, XM_017022536.1:c.536T>C, XM_017022537.1:c.284T>C, XM_017022538.1:c.536T>C, XM_017022539.1:c.536T>C, XM_017022540.1:c.176T>C, XM_017022541.1:c.176T>C, XP_005254693.1:p.Val137Ala, XP_005254694.1:p.Val137Ala, XP_005254695.1:p.Val95Ala, XP_005254695.2:p.Val179Ala, XP_005254696.1:p.Val95Ala, XP_005254696.2:p.Val179Ala, XP_005254697.1:p.Val95Ala, XP_005254698.1:p.Val95Ala, XP_005254699.1:p.Val95Ala, XP_005254700.1:p.Val95Ala, XP_005254701.1:p.Val95Ala, XP_005254702.1:p.Val95Ala, XP_005254702.2:p.Val179Ala, XP_005254703.1:p.Val59Ala, XP_005254704.1:p.Val59Ala, XP_005254705.1:p.Val59Ala, XP_005254706.1:p.Val59Ala, XP_005254707.1:p.Val59Ala, XP_005254708.1:p.Val59Ala, XP_005254709.1:p.Val59Ala, XP_005254710.1:p.Val59Ala, XP_006720730.2:p.Val179Ala, XP_016878023.1:p.Val179Ala, XP_016878024.1:p.Val95Ala, XP_016878025.1:p.Val179Ala, XP_016878026.1:p.Val95Ala, XP_016878027.1:p.Val179Ala, XP_016878028.1:p.Val179Ala, XP_016878029.1:p.Val59Ala, XP_016878030.1:p.Val59Ala

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center